Basic Information

Symbol
RBM8A
RNA class
mRNA
Alias
RNA Binding Motif Protein 8A BOV-1A BOV-1B BOV-1C ZNRP RBM8 Y14 Exon Junction Complex Core Component Y14 RNA-Binding Protein Y14 Ribonucleoprotein RBM8A RNA-Binding Protein 8A Binder Of OVCA1-1 Binder Of OVCA1 BOV-1 RNA Binding Motif Protein 8B RNA-Binding Motif Protein 8A Ribonucleoprotein RBM8 C1DELq21.1 DEL1q21.1 MDS014 RBM8B ZRNP1 TAR
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005105.5
Sequence length
4909.0 nt
GC content
0.4349

Transcripts

ID Sequence Length GC content
AGUUUCCCGAGGUACCUAGUGUCUGAGCGGCACAGACGAGAUCUCGAUC… 4909 nt 0.4349
Summary

This gene encodes a protein with a conserved RNA-binding motif. The protein is found predominantly in the nucleus, although it is also present in the cytoplasm. It is preferentially associated with mRNAs produced by splicing, including both nuclear mRNAs and newly exported cytoplasmic mRNAs. It is thought that the protein remains associated with spliced mRNAs as a tag to indicate where introns had been present, thus coupling pre- and post-mRNA splicing events. Previously, it was thought that two genes encode this protein, RBM8A and RBM8B; it is now thought that the RBM8B locus is a pseudogene. There are two alternate translation start codons with this gene, which result in two forms of the protein. An allele mutation and a low-frequency noncoding single-nucleotide polymorphism (SNP) in this gene cause thrombocytopenia-absent radius (TAR) syndrome. [provided by RefSeq, Jul 2013]

Forensic Context

A study in rats demonstrated that chronic methamphetamine administration altered microRNA profiles in the nucleus accumbens and decreased the transcription and protein levels of the RNA-binding protein 8a (Rbm8a), a protein known to promote neural stem cell proliferation and inhibit differentiation [Yang et al. DOI:10.1080/13880209.2020.1803366].