| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACAGACCGUGUGUUUCCAAAAUGGCGGCAGCGAUGGAUGUGGAUACCC… | 1169 nt | 0.4790 |
This locus encodes a RING finger-like domain-containing protein. The encoded protein interacts with cullin proteins and likely plays a role in ubiquitination processes necessary for cell cycle progression. This protein may also affect protein turnover. Related pseudogenes exist on chromosomes 2 and 5.[provided by RefSeq, Sep 2010]
A longitudinal mRNA expression analysis in post-mortem human blood samples demonstrated that the RBX1 (RBX1), a protein-coding gene involved in nucleotide-excision repair, shows an up-regulated expression pattern after death and was identified as a biomarker for post-mortem interval (PMI) estimation [Antiga et al. DOI:10.1038/s41598-021-96095-z].