| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACCAGCCUUGAGCCCAGCCUGCGGCCAGGGGACCACGCACGUCCCAC… | 2469 nt | 0.5537 |
This gene encodes a member of the recoverin family of neuronal calcium sensors. The encoded protein contains three calcium-binding EF-hand domains and may prolong the termination of the phototransduction cascade in the retina by blocking the phosphorylation of photo-activated rhodopsin. Recoverin may be the antigen responsible for cancer-associated retinopathy. [provided by RefSeq, Jul 2008]
A study in human neonates with hypoxic-ischemic encephalopathy (HIE) demonstrated that the RCVRN was a top differentially expressed gene associated with adverse outcome (death or disability) in the high-income country cohort, showing significant upregulation (log2 fold change, 2.84) and association with hypoxia-induced retinogenesis and HIF-1α signaling [Montaldo et al. DOI:10.1001/jamanetworkopen.2023.54433].