| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUAGGAACAGCCCCGAGCGGCGAGACGGUCCCCGCCAUGUCUGCGGCC… | 3008 nt | 0.3826 |
Predicted to be involved in endoplasmic reticulum membrane organization and regulation of intracellular transport. Located in endoplasmic reticulum tubular network. [provided by Alliance of Genome Resources, Apr 2025]
A study in humans identified the REEP5 as a housekeeping gene with highly uniform and strong expression across 16 normal tissues, proposing it for calibration in biotechnological applications [Eisenberg & Levanon DOI:10.1016/j.tig.2013.05.010]. Subsequent research in mice with sepsis found that the mRNA expression level of the REEP5 did not show a significant difference between cecal ligation and puncture and sham control groups [Yang et al. DOI:10.1038/s41598-025-06463-2]. A study in rats demonstrated that the REEP5 was differentially expressed in the hypothalamus during hypothermia, with 18 tags in control samples versus 4 tags in hypothermic samples, indicating its downregulation in the hypothermic state [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017]. In a separate human study, the REEP5 was identified as a housekeeping gene with highly uniform and strong expression across 16 normal tissues, leading to its proposal as a calibration control for genomic studies [Eisenberg and Levanon DOI:10.1016/j.tig.2013.05.010].