Basic Information

Symbol
REEP5
RNA class
mRNA
Alias
Receptor Accessory Protein 5 DP1 TB2 Polyposis Locus Protein 1 C5orf18 D5S346 Yip2e POB16 Polyposis Coli Region Hypothetical Protein DP1 Receptor Expression-Enhancing Protein 5 Deleted In Polyposis 1 Chromosome 5 Open Reading Frame 18 Protein TB2 YOP1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_005669.5
Sequence length
3008.0 nt
GC content
0.3826

Transcripts

ID Sequence Length GC content
ACUAGGAACAGCCCCGAGCGGCGAGACGGUCCCCGCCAUGUCUGCGGCC… 3008 nt 0.3826
Summary

Predicted to be involved in endoplasmic reticulum membrane organization and regulation of intracellular transport. Located in endoplasmic reticulum tubular network. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in humans identified the REEP5 as a housekeeping gene with highly uniform and strong expression across 16 normal tissues, proposing it for calibration in biotechnological applications [Eisenberg & Levanon DOI:10.1016/j.tig.2013.05.010]. Subsequent research in mice with sepsis found that the mRNA expression level of the REEP5 did not show a significant difference between cecal ligation and puncture and sham control groups [Yang et al. DOI:10.1038/s41598-025-06463-2]. A study in rats demonstrated that the REEP5 was differentially expressed in the hypothalamus during hypothermia, with 18 tags in control samples versus 4 tags in hypothermic samples, indicating its downregulation in the hypothermic state [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017]. In a separate human study, the REEP5 was identified as a housekeeping gene with highly uniform and strong expression across 16 normal tissues, leading to its proposal as a calibration control for genomic studies [Eisenberg and Levanon DOI:10.1016/j.tig.2013.05.010].