Basic Information

Symbol
RELA
RNA class
mRNA
Alias
RELA Proto-Oncogene, NF-KB Subunit Nuclear Factor Of Kappa Light Polypeptide Gene Enhancer In B-Cells 3 NFKB3 P65 V-Rel Avian Reticuloendotheliosis Viral Oncogene Homolog A Nuclear Factor NF-Kappa-B P65 Subunit Transcription Factor P65 NF-Kappa-B Transcription Factor P65 NF-Kappa-B P65delta3 AIF3BL3 CMCU
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_021975.4
Sequence length
2517.0 nt
GC content
0.5860

Transcripts

ID Sequence Length GC content
AUUUCCGCCUCUGGCGAAUGGCUCGUCUGUAGUGCACGCCGCGGGCCCA… 2517 nt 0.5860
Showing 11 to 11 of 11 entries
Summary

NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]

Forensic Context

A study in mice demonstrated that the transcription factor RELA was a key prognosis-related regulator in sepsis-associated acute kidney injury, where its target genes were significantly enriched among downregulated genes in the recovery group [Yang et al. DOI:10.3892/etm.2020.9161]. In human post-mortem tissues, the RELA gene was differentially expressed as part of non-canonical NF-κB signaling mediated by Dectin-1 in the heart and colon during septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that sepsis-induced myocardial injury from cecal ligation and puncture (CLP) led to increased phosphorylation of the RELA at Ser536, indicating NF-κB pathway activation, which was attenuated by treatment with the PI3Kγ-specific inhibitor CZC24832, thereby improving cardiac function and survival [Yan et al. DOI:10.3389/fphys.2022.903164].