| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUCCGCCUCUGGCGAAUGGCUCGUCUGUAGUGCACGCCGCGGGCCCA… | 2517 nt | 0.5860 |
NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
A study in mice demonstrated that the transcription factor RELA was a key prognosis-related regulator in sepsis-associated acute kidney injury, where its target genes were significantly enriched among downregulated genes in the recovery group [Yang et al. DOI:10.3892/etm.2020.9161]. In human post-mortem tissues, the RELA gene was differentially expressed as part of non-canonical NF-κB signaling mediated by Dectin-1 in the heart and colon during septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that sepsis-induced myocardial injury from cecal ligation and puncture (CLP) led to increased phosphorylation of the RELA at Ser536, indicating NF-κB pathway activation, which was attenuated by treatment with the PI3Kγ-specific inhibitor CZC24832, thereby improving cardiac function and survival [Yan et al. DOI:10.3389/fphys.2022.903164].