| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUGACUUAAACUCUGGGGCCCGGGAGGCCGCCGGUUUUCUCCCCGCU… | 6234 nt | 0.3784 |
Predicted to enable histone binding activity and histone methyltransferase binding activity. Predicted to be involved in transposable element silencing by heterochromatin formation. Predicted to act upstream of or within response to bacterium. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the RESF1 gene was upregulated in common in blood leukocytes across three models of systemic inflammation and injury (trauma/hemorrhage, burn, and LPS infusion) at a 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].