| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCCGCGACCGAAGCAGGGCGCGCAGCAGCGCUGAGUGCCCCGGAAC… | 5617 nt | 0.5439 |
This gene encodes a transmembrane receptor and member of the tyrosine protein kinase family of proteins. Binding of ligands such as GDNF (glial cell-line derived neurotrophic factor) and other related proteins to the encoded receptor stimulates receptor dimerization and activation of downstream signaling pathways that play a role in cell differentiation, growth, migration and survival. The encoded receptor is important in development of the nervous system, and the development of organs and tissues derived from the neural crest. This proto-oncogene can undergo oncogenic activation through both cytogenetic rearrangement and activating point mutations. Mutations in this gene are associated with Hirschsprung disease and central hypoventilation syndrome and have been identified in patients with renal agenesis. [provided by RefSeq, Sep 2017] CIViC Summary for RET Gene RET mutations and the RET fusion RET-PTC lead to activation of this tyrosine kinase receptor and are associated with thyroid cancers. RET point mutations are the most common mutations identified in medullary thyroid cancer (MTC) with germline and somatic mutations in RET associated with hereditary and sporadic forms, respectively. The most common somatic form mutation is M918T (exon 16) and a variety of other mutations effecting exons 10, 11 and 15 have been described. The prognostic significance of these mutations have been hotly debated in the field, however, data suggests that some RET mutation may confer drug resistance. Highly selective and well-tolerated RET inhibitors, selpercatinib (LOXO-292) and pralsetinib (BLU-667), have been FDA approved recently for the treatment of RET fusion-positive non-small-cell lung cancer, RET fusion-positive thyroid cancer and RET-mutant medullary thyroid cancer.
No relevant information is available at the moment.