| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACUAUUGCGCCUGCGCCAGCGCCGGCUGCGAGACUGGGGCCGUGGCUG… | 1080 nt | 0.4574 |
This gene encodes a 3'-to-5' exonuclease specific for small (primarily 5 nucleotides or less in length) single-stranded RNA and DNA oligomers. This protein may have a role in DNA repair, replication, and recombination, and in RNA processing and degradation. It may also be involved in resistance of human cells to UV-C-induced cell death through its role in the DNA repair process. [provided by RefSeq, Nov 2011]
A study in mice and rats demonstrated that the REXO2 was identified as a downregulated same-trend differentially expressed gene in the corpus cavernosum of animals with age-related erectile dysfunction, where multi-omics analyses revealed conserved molecular mechanisms involving downregulated mitochondrial activity and extracellular matrix alterations [Long et al. DOI:10.1093/sexmed/qfaf078]. A study in mice demonstrated that the gene Sfn was upregulated in fibroblast subsets Fib0, Fib6, and Fib7 following radiation exposure, indicative of a proliferative cellular state [Yu et al. DOI:10.1186/s40164-025-00596-w].