Basic Information

Symbol
REXO2
RNA class
mRNA
Alias
RNA Exonuclease 2 SFN CGI-114 Oligoribonuclease, Mitochondrial RNA Exonuclease 2 Homolog Small Fragment Nuclease DKFZP566E144 REX2, RNA Exonuclease 2 Homolog (S. Cerevisiae) REX2, RNA Exonuclease 2 Homolog EC 3.1.15.- REX2 SMFN RFN
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_015523.4
Sequence length
1080.0 nt
GC content
0.4574

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-326.70 kcal/mol
Thermodynamic ensemble
Free energy: -347.11 kcal/mol
Frequency: 0.0000
Diversity: 263.21
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((....(((((((((((((..(((((.((....)).)))))..))).((((.((((((.((.(((....)))))))))))..))))((....))..))))))))))..)))).((((((.(((((...))))).))))))((((((.(((...(((.....)))(((((((((.((((.....((..((((((((((.((.(((((((((.((((.........((((((((((((((...(((((((.....(((........)))....)))))))...)))))....((((....))))......(((((.((((((..(((((((((.(((((((...(((((((((.....((.((((((....(((.(((((...)))))...((((((.((......(((.((((.....)))).))).......)).))))))....(((((.((.(((.....))))))))))...(((((((((((((...((.....))...).))))))))).))).......(((((.(((((((....(((((............(((((((...(((((..........((((.....((((...)))).....(((((....(((((......)).)))...)))))..))))..........)))))...)))))))(((((....)))))..........(((((.............)))))....)))))......)))).)))..)))))......)))...))))))))..)))))))))..)))))))))......((........))))))))))))))).)))))))))))))).(((((..((((....))))....)))))...))))))))))))).)).))).......)))))..))..)).....)))))))))))))....((((((.((......)).)))))))))))))))...((((((((............)))))))).....((((((((((((......((((..((((((((......)))))))).)))))))))...........)))))))..
Thermodynamic Ensemble Prediction
((((..{.((((((((((.(({((({((,({.,.{||{|||({,{||.,|{||,|||||{.{,,||{,,.})))}}||||}}..))))||.,..)),.)))))))))).})))).((((((.(((((...))))).))))))((((((.(((...(((...,,}))(((((((((.((((.....((..(((((((((({({.(((((((((.((((.,.{,,,.,({(({,{{,(((((.,.(((((((.,...(((........)))..}.)))))))...)))))}}.,{{||,,..,)))|.....{((((.((((({.,(((((((((.(((((((...(((((((({....{((.((((((....(((.(((({...))))).,,((((((.((......(((.((((.....)))).))).......)).)))))),...(((((.((.({(,....))))))))))...(((((((((((((...((.....))...)}))))))))).)))...,,,.(((((.(((((((....(((((,{{,....,.,,,,,,|((..((((.(((....))).))))..}},((((...)))).....(((((....(((((......)).)))...))))}|{{{.{((((((.{.,,.......}))))}},}.)))},.|||{{..........(((((.............)))))....}}}))}},...)))).)))..)))))...,}})))...))))))))}.)))))))))..)))))))))}...,.,,......,,}}})))))))))))).))))},},}))}},.(((((.|({{{....)))).},.))))),,.))))))))))))).}}.,,},}},,..}))))..)}..)).....)))))))))))))....((((((.((......)).)))))))))))))))|..((((((((............)))))))).....{(((((((((((..,...{,{,..((((((({...,,,}}}},}}}}}}}}))))}..,,,.....})))))))..

Transcripts

ID Sequence Length GC content
GACUAUUGCGCCUGCGCCAGCGCCGGCUGCGAGACUGGGGCCGUGGCUG… 1080 nt 0.4574
Summary

This gene encodes a 3'-to-5' exonuclease specific for small (primarily 5 nucleotides or less in length) single-stranded RNA and DNA oligomers. This protein may have a role in DNA repair, replication, and recombination, and in RNA processing and degradation. It may also be involved in resistance of human cells to UV-C-induced cell death through its role in the DNA repair process. [provided by RefSeq, Nov 2011]

Forensic Context

A study in mice and rats demonstrated that the REXO2 was identified as a downregulated same-trend differentially expressed gene in the corpus cavernosum of animals with age-related erectile dysfunction, where multi-omics analyses revealed conserved molecular mechanisms involving downregulated mitochondrial activity and extracellular matrix alterations [Long et al. DOI:10.1093/sexmed/qfaf078]. A study in mice demonstrated that the gene Sfn was upregulated in fibroblast subsets Fib0, Fib6, and Fib7 following radiation exposure, indicative of a proliferative cellular state [Yu et al. DOI:10.1186/s40164-025-00596-w].