| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUUUCGCCCGCCGUUCCGUGGCGGGAACUGAGGCGACUGUGGGGACA… | 1365 nt | 0.4403 | |
| GCUUUUCGCCCGCCGUUCCGUGGCGGGAACUGAGGCGACUGUGGGGACA… | 1230 nt | 0.4276 |
The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
A study in human neonates with hypoxic-ischemic encephalopathy (HIE) identified the RFC4 as one of 11 significant genes commonly associated with adverse outcome (death or disability) across cohorts from high-income countries and South Asia, though its expression was downregulated in the former and upregulated in the latter cohort in cases with adverse outcomes [Montaldo et al. DOI:10.1001/jamanetworkopen.2023.54433].