| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAUAUUUGCUAAGAGCACCAUGCGCGCAGCAGCCAUCUCCACUCCAAA… | 1352 nt | 0.3757 |
This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
A study in humans identified the RGS1 as a key hub gene via LASSO regression and PPI network analysis, demonstrating its significant upregulation in both myocardial infarction and Alzheimer's disease patient samples compared to controls (p < 0.0001) [Xue et al. DOI:10.3233/JAD-230559]. A study in mice demonstrated that the RGS1 mRNA expression was additively up-regulated in heart tissue by both methamphetamine administration and physical restraint, suggesting its involvement in hypertension through the renin-angiotensin-aldosterone system [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001]. In a separate study in mice, chronic cocaine exposure and withdrawal in the nucleus accumbens led to a sustained decrease in the RGS1 mRNA expression [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X].