Basic Information

Symbol
RGS1
RNA class
mRNA
Alias
Regulator Of G Protein Signaling 1 1R20 BL34 Regulator Of G-Protein Signaling 1 IR20 IER1 Regulator Of G-Protein Signalling 1 B-Cell Activation Protein BL34 Early Response Protein 1R20 Immediate-Early Response 1, B-Cell Specific Epididymis Secretory Protein Li 87 HEL-S-87
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Forensic psychiatry evaluation Drug abuse diagnoses

MANE select

Transcript ID
NM_002922.4
Sequence length
1352.0 nt
GC content
0.3757

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-315.90 kcal/mol
Thermodynamic ensemble
Free energy: -344.51 kcal/mol
Frequency: 0.0000
Diversity: 371.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((.((..(((((((...((((((....((((((...(((((((((((((((...((((((((((((((((((.(((........(((......(((((..........(((((((((.((((....(((....(((((((((((....)))))...((.((((....)))))).(.((((...)))).)(((((((((...(((((.......)))))..)))..)))))).))))))..))).(((((..(.((..(((....)))..)).)...)))))((((((.......))).)))..))))))))))))))))))....)))......))))))))))))))....)))))))(((((.(((.(((((............)))))..((((((((........)))))))).........((((((((......))))))))..................((.(((((....)).)))))))))))))((((((((.(((.............(((((((...)))))))......(((((........)))))...((((.(((......))).))))...............))).))))))))(((((((((((((((.(((((.....(((..(((((((((((((((.(((........((((((((((.(((((.......)))))((((((..((((((((((......((((((((...(((((...))))).))))))))..........(((((.(..(((((.(((......))))))))..)...)))))......((....)).................))).)))..))))....)))))))))))))))).......((((.......)))).........))).))))..)))))..))))))...))).((((((((.......))))))))..(((..(((...(((((...(((...)))...)))))...)))...)))......((((.(((....))).))))..(((.((.((..((((((...(((..(((...)))..))).))))))...)))).)))..)))))))))).))).))))))).......)))))..)))))))))).))))))..))))))((((((((((...((((((((((.......))))))...))))......))))))))))...)))))))..)).))))))))..((((((((......))))))))..((..((((.....(((....(((...............)))..)))....))))..)).........................
Thermodynamic Ensemble Prediction
.((((((((.{{..(((((((,{.((((((....((((((...(((((((((((((({...((((((((((((((((((.(({........((((.((((,({.....,)}.)))).)))},{,{........,,.....(((((((((((((((((((....((.((((....)))))){((((((..,{{....(((((((((.,.(((((.,....,))))).}))),.,))))).,.,|,{{{{,,...}}},..,}}..))))))}..,,,,((,,....,}}},,}}}{(({...})))))))).)))))))}..,))))))...}}|||....,))}))))))))))),...}))))))((((({(({,(((({............}})))..((((((((........)))))))).........((((((((......))))))))..........{{,....,}}.{{{{{....}},}}|,,,}}}))}|((((((((.(((,,,..........((((({|...})))))).....,{((((........)))}|,..((((.,{{...,,.|||,}}}}.......,,......}}}.}))))))),{{{{((((((((((,{{{{|,},..{{{,.{(({((((({,{{{,}|||..,,....{{{,{{{{{..(((((.......))))){{|{{||||{{{(((,|{...,..{{{{((({,||||||,.,,))},),)))))))).....,....(((((.(..(((({,(((......))))))))..)...)))))......((....))............{{.{{{((((((..,........}.))))))),)),)).......,|||,||,||||}}}..,.,...,}})|}}}}..}})))..})))))...|||.((((((((.......)))))))).}||,..{{,...(((((,{,,,,...}))}..,}))}..{||....)))......({{{,{{(....}}},)))).}|||,{|,{|,,{(((({...{{{..{{|...)))..))).))))},.,.)))),))),.))}))))))),))).))))))}.......))))},.)))))))))).))))))..))))))((((((((((...((((((((((.......)))))},,.,,,}......))))))))))}}.)))))))..}}.)))))))),.,(((((((......))))))}|{{({..,{{{....,}.}...,|||,..,,,,,,{{.,,.}}}..,,,....,}),,}}},,,,.....................

Transcripts

ID Sequence Length GC content
GCAUAUUUGCUAAGAGCACCAUGCGCGCAGCAGCCAUCUCCACUCCAAA… 1352 nt 0.3757
Summary

This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the RGS1 as a key hub gene via LASSO regression and PPI network analysis, demonstrating its significant upregulation in both myocardial infarction and Alzheimer's disease patient samples compared to controls (p < 0.0001) [Xue et al. DOI:10.3233/JAD-230559]. A study in mice demonstrated that the RGS1 mRNA expression was additively up-regulated in heart tissue by both methamphetamine administration and physical restraint, suggesting its involvement in hypertension through the renin-angiotensin-aldosterone system [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001]. In a separate study in mice, chronic cocaine exposure and withdrawal in the nucleus accumbens led to a sustained decrease in the RGS1 mRNA expression [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X].