Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCUCCUCCUCCUCGCCUUCCUCCGGCUCAGCCGCCGCGCCGCCGGGC… | 923 nt | 0.4756 | |
| CUUCGGACCCAAGGGUGCUCGGGAGCCCUCCAGUCUCUGCCUUUCUCAC… | 916 nt | 0.4520 |
Summary
Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 10 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. This protein associates specifically with the activated forms of the two related G-protein subunits, G-alphai3 and G-alphaz but fails to interact with the structurally and functionally distinct G-alpha subunits. Regulator of G protein signaling 10 protein is localized in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Forensic Context
A study in mice demonstrated that the RGS10 mRNA is upregulated in primary cortical astrocytes following treatment with the cytoprotective CO-releasing molecule CORM-A1, an effect validated by qRT-PCR [Oliveira et al. DOI:10.1007/S12035-018-1302-7]. A study in mice demonstrated that chronic cocaine exposure and withdrawal induced sustained down-regulation of the RGS10 in the nucleus accumbens, as part of a broader heterotrimeric G-protein signaling pathway response [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X].