| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUGCAGGCUGCUAAACCCAACCGCAGUUGACUAGCACCUGCUACCGC… | 2408 nt | 0.5316 |
The protein encoded by this gene belongs to the 'regulator of G protein signaling' family. It inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits. It also may play a role in regulating the kinetics of signaling in the phototransduction cascade. [provided by RefSeq, Jul 2008]
A single-cell transcriptomic analysis in a rat model of radiation-induced lung injury identified the RGS16 as an orthologous rat gene associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].