Basic Information

Symbol
RGS2
RNA class
mRNA
Alias
Regulator Of G Protein Signaling 2 Regulator Of G-Protein Signaling 2 G0S8 Regulator Of G-Protein Signaling 2, 24kDa Cell Growth-Inhibiting Gene 31 Protein G0/G1 Switch Regulatory Protein 8 Regulator Of G-Protein Signalling 2, 24kDa Regulator Of G-Protein Signalling 2, 24kD G0 To G1 Switch Regulatory 8, 24kD Cell Growth-Inhibiting Protein 31
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_002923.4
Sequence length
1348.0 nt
GC content
0.4154

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-358.60 kcal/mol
Thermodynamic ensemble
Free energy: -385.44 kcal/mol
Frequency: 0.0000
Diversity: 317.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((..((.((((.((((((((((((.....(((...)))..))))))).((((((((((((.(..(((..(.(((((((....((....))...(((((((.....((((((..(.(((((.((.(.((((((...(((((((....)))))))..)))))).).))..))))).)....))))))...(((((((..(((((.....((((....((((.........))))(((.((..(((((((((.(((((((.(((((...((((((....)))))).)))))...))((((((........))))))......((((((((((..(((((((((((...............)))))))))))((((((((...................................((((........)))).........(((((((((.(((((((((..(((((...(((..........................((((......))))......(((.(((((....))))).)))......(((((......))))).....)))..)))))...........))))..))))))))))))))...........((.(((((........))))).))..))))).)))(((((...))))).......)))))))))).((((((.....)))))).......))))).)))))))))..)))))..)))).......((((........))))..))))).))))))).......((((((.(((((((((..((((.(.....((.(((((.(.((((((..((.......))..)))))).(((((.((.(((((((...(((((.....)))))...)))))..)).)).)))))((((..((((((..((......(((....)))........))..)))))))))).....).))))).))....)))))..))))))))).))))))....)))))))...((((((((((((.................))).))).)))))).(((..((((((((((......((((.......))))....((((.(((.(((((((((((((.(.(((.........))).).)))))))))))))..))))))).))))))))))..))))))))))...((((((((...))))))))............)..)))..).))))))).....)))))..)))))..)))).))......)))).((((((((.(((.((...)).))).)))))))).....(((((((.((((((....))))))..)))))))
Thermodynamic Ensemble Prediction
.{,.,..{{,((,((((,{{(((((({{{,.,...((,..,||||,|||||}|,((((((({{{{{.{..|||}.,,||{||||}..|||}|.,||,,,(((((({.,...((((((..,.(((((.((.(.((((((...(((((({....}))))))..)))))).).))..))))).,....))))))..,||{(({|..{||{,.....|||{...,((((.........))))|((,({,{(((((((((.((((((,.(((((...((((((....)))))).)))))...||((((((........))))))}.....((((((((((..(((((((((((.{{,.......}},.)))))))))))((((((((..{,...........................{,{,((((........}))}.........(((((((((.(((({((((,,((({{...({{,...........}}},..........((((......))))......{((.(((({....})))).))}......(((((......)))))...,,}}}..}}|||.....,,},..))))..))))))))))))))....,,....}||.(((((........))))).))..))))).)))(((((...))))).......)))))))))).((((((.....))))))......,))))).))))))))).})}))}.,||}}....{(.((((........}))).|}}})}.})))))}...,...((((((.(((((((((..{{(({{{,,..({.,{{{{...((((((..((.......}}..)))))).(((({.((.(((((((...(((((.....))))).,.)))))..}).)).))))){{{{.,{{((((..((,.....{{{....}}}.....,,.)}..))}))}}})}....}}}}}}})}}}...,)})))..))))))))).))))))....)))))))...((((((((({((.................))).))).)))))).(({,{(({(({{{{{{{,{{{,{((....(({{..{{{{{{{((.(((.(((((((((((((.(.(((.........))).).)))))))))))))..)))))))})))..,))))..,))))))}}},,{((((((({...,})))))),,,,,.,,,..,}..)))}}),}}}}}}),..,,))})}.,)))}}..)))).))......|||||{|,,{|||}|{{.({,...,.}))})}})))}}.....{((((((.,{(((({,..,,)))),,)))))),

Transcripts

ID Sequence Length GC content
GCAAACAGCCGGGGCUCCAGCGGGAGAACGAUAAUGCAAAGUGCUAUGU… 1348 nt 0.4154
Summary

Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. The protein acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. [provided by RefSeq, Aug 2009]

Forensic Context

A study in mice demonstrated that the mRNA expression of the RGS2 was additively up-regulated by both methamphetamine administration and physical restraint without interaction, suggesting its involvement in hypertension through the renin-angiotensin-aldosterone system [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001].