| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAAACAGCCGGGGCUCCAGCGGGAGAACGAUAAUGCAAAGUGCUAUGU… | 1348 nt | 0.4154 |
Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. The protein acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. [provided by RefSeq, Aug 2009]
A study in mice demonstrated that the mRNA expression of the RGS2 was additively up-regulated by both methamphetamine administration and physical restraint without interaction, suggesting its involvement in hypertension through the renin-angiotensin-aldosterone system [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001].