| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAUUCCCGGGCGGGCCGGACCGGCGGGCGGGCGGGGACUCGGCGCGGG… | 2992 nt | 0.6287 |
Predicted to enable growth factor binding activity and serine-type endopeptidase activity. Involved in several processes, including negative regulation of protein secretion; regulation of epidermal growth factor receptor signaling pathway; and regulation of proteasomal protein catabolic process. Located in Golgi membrane and endoplasmic reticulum membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the RHBDF1 was identified as a hub node among ventral midbrain (VMB) differentially expressed genes overexpressed in the methamphetamine low drinking (MALDR) line, with its network connectivity differing by at least 0.5 between selectively bred lines, and it was a hub in the green coexpression module [Hitzemann et al. DOI:10.3390/brainsci9070155].