Basic Information

Symbol
RHBDF1
RNA class
mRNA
Alias
Rhomboid 5 Homolog 1 IRhom1 EGFR-RS C16orf8 Dist1 Epidermal Growth Factor Receptor-Related Protein Inactive Rhomboid Protein 1 Rhomboid Family Member 1 P100hRho FLJ2235 Epidermal Growth Factor Receptor, Related Sequence Chromosome 16 Open Reading Frame 8 Rhomboid 5 Homolog 1 (Drosophila) Rhomboid Family 1 (Drosophila) Rhomboid Family 1 Gene-89 Gene-90 HDist1 IRHOM1 DIST1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_022450.5
Sequence length
2992.0 nt
GC content
0.6287

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1272.20 kcal/mol
Thermodynamic ensemble
Free energy: -1323.47 kcal/mol
Frequency: 0.0000
Diversity: 771.81
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((((((.(((..((((((((..((((((.(((.(((.((((.....)))).))).)))........)))))).)))))..((((((..((((.(((..(.((((((((((((((((((((((((........)).)))))))))....(((((.(((((..((((((.(((((..((((((.(((.(((((....)))))..........((((((((.(((((.((((((...((...(((((((..(((((((((((..((((...((((((.((((.((((...(.(((((.....((((((.....(((((.((((((...(((....((.(((((((((((....((.(.((((...((((.(((((((((.((.((....)))).)).)))))))..))))((..((.(((((((.((..(((....)))..))((....))....)))))))...)).))(((.(((....))).))).((((.(((....))).)))).((((......))))...)))).).))....))))))))....))).))....)))...)))))).((((((.....))))))..))))).....((((...(((((...))))).((((((((((((........))).)))))))))(((.(((((.......((((((((.(....((((((((((((....(((........)))(((((((((.....((((((((((.(((.((...))..))).))))))))))......)))))...(((((((((...............)))))).)))...)))).(((.......)))(((.((....(((((((((((...(((((..((((.(((((((............((((((.(..(((..(((....)))..)))..)..))))))...))))))).)))))))))(((........)))))))).)))))))).)))...))))))))))))...)))).)))))..))))))))((((((((((...((((.(((((..(((((..(((((((((((((.((((.(((((((...(((((((((((.(((.(((((.(((..((.........)).)))))))).)))...)))))).))))).((....)))))))))..(((((((((((((.(...).))))......)))))))))..)))).)))))))..((((((((.((((.((((...((((((((((..((((((.(((........)))..))))))....((((...(((......)))..))))..((.((((((..((.((((....(((((..............)))))....)))).)).)).)))))).........((((((......))))))...((.(((((((..(((.(((((((((((.(....).))).))))))))))))))))))))..(((....)))......(((.(((.((.....)).))).).)).))))))))))..))))))..))..))))))))...............)).))))))))).))))).))))....(((((.(.((((((.....)))))).).)))))..)))))))))).(((.....)))...)))))))))).(((((((..((((((((((...(((((((((((((((....((((((......)))))).....)))))((((..((.((((..(((......((((((.......)))))))))..)))).))...))))))).))))))))))))))))).............((((((...............)))))).)))))))..........))))).)..((((((..((((......)))).(((((....)))))....((((((.(((....))).).))))).))))))...))))))))))))))..))))..))))...))))))).........)))))))...)))))))).))))).))))))))(((((((((((((((((((((((((.((((((...((((..((((..((..((.......(((...))).......))))..))))..)))).....(((((....))))).((((((....))))))...((((....))))...))))))..))))))..))).)))))))..)))))))))..(((((.(((....)))))))).((.((((.((((((.....(((((...(((.(.(((((((((((.((((((((...)).))))))....))))))))))).).)))((((((...)))))))))))....))))))))))..)).))).))))))...))))).)))))).))))).)))))..........))))))))))))).)(((((.......((((........))))...)))))(((...............)))..((((((.............))))))...((.(((((.((....)).)).))).))........(((((.(((((....))))).)))))..))))))).)))))).......)))..))).)))))).....((((.(((((...)))))))))......(((((.((.....)).))))).(((((((.((((((((.((((((....)))))((((((........))))))).))).)))))((((.(((.(((((....(((.(((.(((((((...)))))))..)))))).(((((.....)))))..))))))))...))))..((((((......)).))))....((((((....).)))))...))))))).)))))((((((((...........(((((....................))))).((((.....))))..))))))))...(((.(((......))).))).........
Thermodynamic Ensemble Prediction
.....{((((((((({,(((,.(((((((({,((((((,{,({({(,(({{..,,,)))).}||{|||..|||...}})))),))))}..((({{(..{(((.(({.,{,(((((((((((((((((((((({{........},.)))))))))..{.(((((.(((((..((((((.(((((..((((((,(((,{,|||....|||({,{,,,,|,,.((((((((.(((((.(((({,.{{((...(((((((,.(((((((((((,.((((...((((((.((((.((({{,.(,(({((...{,||({{{|||.,|||||...{{{{,,,{((,,,.(({({{((((((((...,({.,.,{(({{.((((.(((((((((.((.((....)))).)).)))))))..)))),...||,|{{||{|,||,,|((....|))..|}{{....))....))}}))),.,||,||{{{.{||,..,))).})),((((.(((....))).)))).{{((,,{,|{}}||.,..|||.|||}||..}}}))})),.,))}}..{{((((.....)))))|,{({(((,|..|||||||..|,,,..|||.|,|||,|||||{.,}))))|.((((((((((((........))).)))))))))|{{.((({{...,.,.((((((((.(....((((((((((((....(((,,,,,..{|||((,,(((((..,,.((((((((((.(((.((...))..))).))))))))))..,,..)))))...(((((((((....,.....,}...)))))).)))...}|||.((,,{{{{,{,||((({(.,{,.,,((((||,,..{((((((..{,,({{((,((({{.{,....,}.||||||}|,.{||}}|||....,,}..}},}})}})))))))).}))))),.}},)))))){{{........)))})))),,,,})))}.,,....))))))))))))...)))).)))))..}||||||,((((((((((...((((.(((((..(((((..(((((((((((((.((((.(((((({...(((((((((((.(((.((((,{(((..((.........)).)))))))).)))...)))))).))))),((....))))))))),.(((((((((((((.(...}.))))......)))))))))}.)))).)))))))..((((((((.{{((.((((...((((((((((.{((((((.(((........)))..))))))}...((((.{.(((......)))..))))..((.(((({{..((.((((....(((((..............)))))....)))).)).}}.)))))).{{{{{{..((((((,,,...}}}))).,,{{.(((((((..(((.(((((((((((.{....}.))),,))))))))))))))))),,...||,,.,{||,..,,}})),|||,{{|,...,},)))))).)}))))))))))..))))))..))..))))))))....,.....,,...)).))))))))).))))).))))....(((((.{.((((((.....)))))).}.)))))..)))))))))).}||||,{.,,|.|||}}}|}|}}}}{{||{{{.,((((((((((...(((((((((((((((..{.((((((......)))))).}.,.)))))((((..({.((((..(((.....,(({(({.....,,))))}})))..)))).})...))))))).))))))))))))))))).,...|,,,,}.}}(((({,..|..........,)))))}.)))))}}........},))))).,.,((((((..{{{{......,})).(((((....)))))..,,((((({.(((....))).}.})))).))))))...})))))))))))))..))))..)))),..})))))).,......,)))))))...)))))))).))))).)))))))).||{{|||||{{{{((((,,,,|||,,,{{{{...{,,|}}|{({,|{,||{{||,,..,(((,,,))}....,,...{{{{||{(((((((...........)))))))}.((((((....))))))...,,,,.}}}))),..)))))))}}))))))},|||{||||,||{{,,,,,,,,...,||||.|||}}}}))}}||||.{{.((((.((((((...,.(((((...(((.(.(((((((((((.((((((({...}),})))))....))))))))))).).)))((((((...))))))))))),...))))))))))..)).))).))))))...))))).)))))).))))).))))),.........)))))))))))))}){,{{{..,....((((........))))...}}})}(({...,{||......,{|,,..((((((........,....)))))),,)),,,,},.,,))}|,,|||}||(({({,,..,,..,((((.(((((....))))).))))).,))))})).))))}}.......}}}..}}}.}}}}}}.,.{(((((.(((((...))))))))).}}...{((((.((.....}).))))).(((((((.(((((,(({((({{{..,,))))|((((((,,...,,.))))))}.},}.)))))((((.(((.(((((....((,,(((.(((((((...)))))))..)))))).(((((.....))))),.))))))))...))))..((((((......))}})))....((((((....),}))))...))))))),)))))|{{{{{{{............((((.,,...........},,...))))),((((.....)))),,)}}}}))),..|||.{||,,....))).)}}.........

Transcripts

ID Sequence Length GC content
GCAUUCCCGGGCGGGCCGGACCGGCGGGCGGGCGGGGACUCGGCGCGGG… 2992 nt 0.6287
Summary

Predicted to enable growth factor binding activity and serine-type endopeptidase activity. Involved in several processes, including negative regulation of protein secretion; regulation of epidermal growth factor receptor signaling pathway; and regulation of proteasomal protein catabolic process. Located in Golgi membrane and endoplasmic reticulum membrane. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in mice demonstrated that the RHBDF1 was identified as a hub node among ventral midbrain (VMB) differentially expressed genes overexpressed in the methamphetamine low drinking (MALDR) line, with its network connectivity differing by at least 0.5 between selectively bred lines, and it was a hub in the green coexpression module [Hitzemann et al. DOI:10.3390/brainsci9070155].