| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGAGGGUCAUGACGCAGCGAGUUUCAGUCGUGACUUUUCUGGGGGCAU… | 2046 nt | 0.4800 |
This gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. This protein is vital in regulation of growth and cell cycle progression due to its role in the insulin/TOR/S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of the protein is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22. [provided by RefSeq, Jul 2008] CIViC Summary for RHEB Gene
No relevant information is available at the moment.