Basic Information

Symbol
ATP5F1B
RNA class
mRNA
Alias
ATP Synthase F1 Subunit Beta ATP5B ATPSB ATP Synthase, H+ Transporting, Mitochondrial F1 Complex, Beta Polypeptide ATP Synthase F(1) Complex Subunit Beta, Mitochondrial ATPMB Mitochondrial ATP Synthetase, Beta Subunit ATP Synthase Subunit Beta, Mitochondrial Mitochondrial ATP Synthase Beta Subunit Epididymis Secretory Protein Li 271 EC 3.6.3.14 EC 7.1.2.2 HEL-S-271 EC 3.6.3 HUMOP2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001686.4
Sequence length
1759.0 nt
GC content
0.5060

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-595.20 kcal/mol
Thermodynamic ensemble
Free energy: -628.37 kcal/mol
Frequency: 0.0000
Diversity: 642.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((..(((((((.......)))..))))..)))))))((((.(((((((...)))))))...))))))))).....(((((((...((((....))))((((((....((((((((((((.....)))))))).((((....))))......((((.((........))))))....))))(((((.((((.(((((((((((((.(.((((((.(((((((.(((..(((((.....((((((((((.(((.((........))...))).)))((((((((.((((((((...)))))((((((((((((((.((..(((((....(((((.....((.((...((((((.((((((((.((.(((((((((..(((((((.(((((((...)))))))...........((((((((.((((((((.((((((((.....((((((((.....((((......((((((..........))))))..............)))))))))))).....)).)))))))))).))).........).)))))))).)))))))..)))..)))))).)).....((((((((((((...((((((((..(((........))))))))))).....))))))))).))))))))))).))))))...)).)).....))).))....))))))).)))......(((.(((((.(((.((......)).))).))))).))).((((..((((((.((..........)))))))).))))...........))))))))))).(.((((((((....((((((......)).)))).)))))))))((((...(((((((((((.(((((.(((.(((((((((...))))).((((.....))))(((((((....(........)...)))))))............(((.((((((((((((((.((........)).))(((((((((((((((((((...)))))))...)))..(((.(((((...))))))))...................)))))))))....))))))))..(((((.........)))))..............))))..))).......))))))).))))).))))).))))))...))))..)).).)))).))))..(((((((......)))))))(((((((.....)).))))))))))))....))))).))).))))).)).)))))).).)))))))).)))))))))))))).....((((((.(((..........))).))))))....(((((((((((((.((((.........((((((((((...((((.((((((.....))))))......))))...)))).))))))))))))))))((((((.(((((((.((((...(((.((....)).)))..))))..)))))))(((....)))..)))))).((((((.(((((........))))).))))))..(((.((((..((((......))))...)))))))))))))).)))))).......)))))))........((.((((((((......(((..(((((((..((((...(((.((((((..(((((......)))))..)).))))..)))..))))....((..(((......)))..))...)))))))...))).................)))))))))).
Thermodynamic Ensemble Prediction
{(((((((((({{,({{{{((.....,|}}|.,}}||.,}||||}}((((.(((((((...)))))))...))))}}))),,,,,(((((((...{{((....||||,{{(({....{{{{((((((((.....)))))))).((((,.,,||}}....,,((((.({........}}))))....)))}(((((.(((,,(((((((((((((,(,((({{(.{(((((({(((.,(((((....,((({(((,{,.{{,,{{...,,...||{{.||,.|||{||.||||{{|,{((({...}))}}||||{|||||{{(({({..((((({,,,(({{({{,,.,{,,{||,||,{{{,{{{(((((..(((((({{{{(|||(((({..,.,{{,{,{.|||||.{((({.......((((((((.{(((((({{((((((((...,.((((((((.....((((......((((((.......,..))))}}...{{{....,}}})))))))))))).,...)).)))))))))).))).........}.)))))))).}}.))))}}}}}|,}}}.,},|,,,|..||{{((((({{{,,,{((({{(({{(((,....,{,||}|}}||||||,|..}|}}||||},.|||}}|}}||,||||||,|,|,,|},.,..|}},}}},..})}}}||{|||,,.,,|{((|({(((,{((,(({.,,..||,}}},}}}}},)}|.((((..((((((.{{..........}))))))).}))}........|,|}|}||||||,||,|{|{||||||,..,(((((......})||))|(((((,({....||||||}|(((((,,,.,))))),.}}||||((((,...})))).((((.....))))(((((((....,,,,.....),,,)))))))..,}}})},)))))}))|}}{|{||{|{,{.||},,..,}|)}.||{(((((((({,,(((({{{...}|||}}}...))),.{({.(((({...}})))))),...,,....}}}}.....))))))))},..,|}}}}}},..(((((.........))))).,,..,,..,,,..}}))))))}..})).})}..,,..})})),))))}}))))))}))))})}}))})|||||{|||||,(((((({......}))))))({(((((,....}|.}}}}},,}}})}....})))),))}.}}}})}}),)))))},),)))))))),}))))))))))))).....{((((|,{((,......,,,))}.}}))}|....,{{{{||||||||.{{||.......,,((((({{(((.,,({{(,((((((.....))))))....,.)})}.,,}))),)))||||}}}}}}}))|||{{(.(((((((.((((...(((.((....)).))}..))))..))))))).|{,..|}}},,))))}}.{(((((.(((((........))))).)))))},,{|,|{{{{..||||}||,,.))}},}}}}||}}}}}}}}},.{|||,...)))),))))})).}......{{.((((((({...,{,{({..(((((((,,{{{{...{{{.{{{,,{.,{{{{(,.....}}}}}..)}}}))),,)))..}})),,,.{{..((({{....,)),,)}.},}))))))...))).............,...)))))))))}.

Transcripts

ID Sequence Length GC content
AGUCUCCACCCGGACUACGCCAUGUUGGGGUUUGUGGGUCGGGUGGCCG… 1759 nt 0.5060
Summary

This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the beta subunit of the catalytic core. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that in vivo α-particle irradiation of Kupffer and endothelial liver cells induced a characteristic inflammatory state, with the ATP5F1B (Atp5b) being commonly down-regulated by less than half in all irradiated groups compared to non-irradiated controls [Roudkenar et al. DOI:10.1269/jrr.07078]. This down-regulation of the ATP5F1B, a gene involved in ATP synthesis, was part of a broader gene expression profile that distinguished radiation exposure from chemical hepatotoxicants.