| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUCCACCCGGACUACGCCAUGUUGGGGUUUGUGGGUCGGGUGGCCG… | 1759 nt | 0.5060 |
This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the beta subunit of the catalytic core. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that in vivo α-particle irradiation of Kupffer and endothelial liver cells induced a characteristic inflammatory state, with the ATP5F1B (Atp5b) being commonly down-regulated by less than half in all irradiated groups compared to non-irradiated controls [Roudkenar et al. DOI:10.1269/jrr.07078]. This down-regulation of the ATP5F1B, a gene involved in ATP synthesis, was part of a broader gene expression profile that distinguished radiation exposure from chemical hepatotoxicants.