| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUGCCACCGCAGUCUGGUUGGAGCUGUUGUCUUGUAUGCUCAGCGAG… | 2367 nt | 0.5746 |
Predicted to enable GTP binding activity and GTPase activity. Involved in several processes, including cellular response to hydrogen peroxide; cellular response to ionizing radiation; and regulation of cell migration. Located in cleavage furrow and endosome membrane. Biomarker of breast cancer. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans analyzing blood samples from pediatric and adult burn patients using a factorial time-course microarray method (TANOVA) identified that the RHOB exhibited a main effect related only to age and not to burn injury, classifying it into a group of genes involved in processes like nitric oxide and reactive oxygen species production in macrophages associated with aging [Zhou et al. DOI:10.1073/pnas.1002757107].