| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCCUUCUCGAGCCCGGAGCCGCUGCCGCCGCCCCCAGCUCCCCCGC… | 1295 nt | 0.6000 |
This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein facilitates translocation of a functional guanine nucleotide exchange factor (GEF) complex from the cytoplasm to the plasma membrane where ras-related C3 botulinum toxin substrate 1 is activated to promote lamellipodium formation and cell migration. Two related pseudogene have been identified on chromosomes 20 and X. [provided by RefSeq, Aug 2011]
A study in mice demonstrated that the RHOG was down-regulated in brain tissue at 8 hours (0.533-fold) and 24 hours (0.504-fold) following whole-body irradiation, identifying it as a cell cycle marker responsive to ionizing radiation [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418]. In human sepsis research, the RHOG was identified as a protein-coding gene with mRNA expression patterns consistent with its corresponding protein, classified within quadrants 3 or 7 of a nine-quadrant analysis during multi-omics screening for potential diagnostic biomarkers [Wang et al. DOI:10.2147/IDR.S380137].