Basic Information

Symbol
RHOG
RNA class
mRNA
Alias
Ras Homolog Family Member G ARHG Ras Homolog Gene Family, Member G (Rho G) Rho-Related GTP-Binding Protein RhoG MGC125835 MGC125836
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_001665.4
Sequence length
1295.0 nt
GC content
0.6000

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-505.60 kcal/mol
Thermodynamic ensemble
Free energy: -524.74 kcal/mol
Frequency: 0.0000
Diversity: 247.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((((..((((..(((((.(..(((....(((((((((...))))).))))....)))..).))))).((((((((((((((...((.((((((...))))))..((((((..(((((.......))))).((((((((.(((.(.(((((((.(..(((((.(.(((((((..(((...((......))..)))..))...(((((......)))))...........(((((((.(((((...((((.....))))))))).))))))).(((((..((.........))..))))).(((..((((((.(((((........))))).).))))).))).((((...(((....)))..))))..((((((..(((((((((..(((..((((((..((((((((...(((((((((...)).)))))))...))))((...(((((((.((....)))))))))..)).((((((...((((.((((((((((.(((.(((((......(((((..((((((((((((..(........)..))))...)).))))))..))...))).......(((((.(((.((.(((.((..((((...)))).))))))).))).))))).)))))))).))).))))))).))))...(((((((.......))))))).))))))))))..)))))))))..))).)).)))).)))))).)))))).)))))..)))))))).)..))))))))))).............))))))((....)).))..)))))).))))))))...((((((..((((((.(((((((((((((((.((((((((......)))))))))).)))))))))))))))))))....)))))))))))))))))))(((((((.......(((((((............((((((...((((.....))))))))))((((((...............)).))))...))))))).(((((........))))).(((.(((((....(((((.....((((((((((((..(((.((.((((.....((((........((((((((..........)))))).))...(((((((.......)))))))...)))).....)))).)))))..)).)))))))))).......)))))))))).....)))...(((((.....)))))....(((((..(((((...........)))))..))))).................)))))))
Thermodynamic Ensemble Prediction
......{((((((((..((((..(((((.{..(((....(((((((((...))))).))))....)))..}.))))).((((((((((((((..,{{.((((((...)))))).,|,{{{{..(((((,....}.))))).((((((((.(((,(,(((((((.(..(((((.(.(((((,,..((({{{(,{{{.{{||..,,,......,{(({{......})|}}...........(((({|{.,,,,,..,||||,....)})))),))}))))))).(((((..((.,.......))..}}))).(((..((((((.(((((........))))).,,))))).))).((((...(((....)))..))))..{(((((..((((((,,({{(((.,((((((..((((((((...(((((((((...)).)))))))...))))((...(((((((,({....)))))))))..}).((((((...((((.((((((((((.(((.(((((,,....||{((..((((((((((((..{........|..))))...)).))))))..||...,,,..,}},.(((((.(((.(,.(((.{{..((((...)))).))))))).))).))))).)))))))).)))},)))))).))))...(((((((.......))))))).))))))))))..)))))})))..}))}))}}))).)))))}.)))))).))))).,)))))))).}..)))))))))))...{,,,......|}}}}}|,....)),),..)))))).)))))))}...((((((..((((((.(((((((((((((((.((((((((......)))))))))).)))))))))))))))))))....)))))))))}))))))))}(((((((........{({(((......}}}...((((((...((({.....))))))))))((((((...............)).))))...||},,,..{{(({........))))).,||,|{{{{...,||{{{.{...((((((((((((..((,{((.((((.....((((........((((((((..........)))))).))...((((({{{......)))))))...)))).....)))).)))))..)}.)))))))))).......)})))})))).....}},...(((((.....)))))....(((((..(((((...........)))))..)))))..............,..}))))))

Transcripts

ID Sequence Length GC content
ACUUCCUUCUCGAGCCCGGAGCCGCUGCCGCCGCCCCCAGCUCCCCCGC… 1295 nt 0.6000
Summary

This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein facilitates translocation of a functional guanine nucleotide exchange factor (GEF) complex from the cytoplasm to the plasma membrane where ras-related C3 botulinum toxin substrate 1 is activated to promote lamellipodium formation and cell migration. Two related pseudogene have been identified on chromosomes 20 and X. [provided by RefSeq, Aug 2011]

Forensic Context

A study in mice demonstrated that the RHOG was down-regulated in brain tissue at 8 hours (0.533-fold) and 24 hours (0.504-fold) following whole-body irradiation, identifying it as a cell cycle marker responsive to ionizing radiation [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418]. In human sepsis research, the RHOG was identified as a protein-coding gene with mRNA expression patterns consistent with its corresponding protein, classified within quadrants 3 or 7 of a nine-quadrant analysis during multi-omics screening for potential diagnostic biomarkers [Wang et al. DOI:10.2147/IDR.S380137].