| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCUCCUGCGCGCCCCUCCGCGCGGCCCUCGCAGGGAGUGGGGCUCGG… | 4780 nt | 0.4234 |
This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein is an important signalling protein for sarcomere assembly and has been shown to play a significant role in the exocytosis of the solute carrier family 2, facilitated glucose transporter member 4 and other proteins, possibly acting as the signal that turns on the membrane fusion machinery. Three related pseudogene have been identified on chromosomes 2 and 14. [provided by RefSeq, Aug 2011]
A study in humans demonstrated that the RHOQ was downregulated during long-term weight loss (0 to 12 months) in weight losers within subcutaneous adipose tissue [Bollepalli et al. DOI:10.1038/ijo.2017.245].