Basic Information

Symbol
RHOQ
RNA class
mRNA
Alias
Ras Homolog Family Member Q TC10 RASL7A ARHQ Rho-Related GTP-Binding Protein RhoQ Ras Homolog Gene Family, Member Q Ras-Like Protein Family Member 7A RAS-Like, Family 7, Member A Ras-Like Protein TC10 Epididymis Secretory Protein Li 42 HEL-S-42 TC10A
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_012249.4
Sequence length
4780.0 nt
GC content
0.4234

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1421.44 kcal/mol
Thermodynamic ensemble
Free energy: -1518.15 kcal/mol
Frequency: 0.0000
Diversity: 1232.81
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((((..(((...((((((((((((.((......(((.((......)).))))))))))))))))).))).))))).))(((.((((((.(((.((((((((..((..(.(((((((((((((((((((((.(.(...).).)))))(((((.(((((.((((((((((......)))))).(((((((((((((((.(((((((((......(((((((((((.((((.(.(((((((....)).))))).)...)))).))))))))..)))..))).)))))))))))((((....)))))))).)).))))...)))).))))).)))))))))))))..)))))))).)..))..))).)))))(((((.((((((((((((((((((((((((....))))))))((........))(((.(((((((.((((((((.(((......))).)).))).))).).)))))).)))((.((.((((...)))).)).)))))))))((.(((((((.(.....).))))))).))(((((((....)).)))))..))))))))).)))))((((((..(.((((((((((((((.((((((((((((((((.....))))))))..((.((...))))(((((.((((....)))).)).))))))..))))).)))))))))))))).).)))))).((..(((((..........)))))..)).......(((((((.((....((((((....(.((......)).)....)))).))...)).))).))))(((((((...(.(((.((((.....(((((.((((.(((((.....)))))))))..))))))))))))).)))))))..))).)))..))).)))......(((((((....(((..(((.....)))..)))...((..(((((......((((...((((.(((((...(((.(((((.......((((((((((.((((((((((.((((((.((((((.((((...)))).))))))........(((....)))..((((((.(((((((.(((.(((((...)))))...............................(((.(((((................))))).))).....))).)))))))))))))((((.(((((...((((.((((((...............))))))..)))).......((.((((.....))))..))(((((((((....(((((.(((.......((((.......(((....(((((((((.((((((.(((........(((((.(((.((........)).))).)))))))).)))....))))))))))))))).......))))....))).)))))(((((.....((((...((.((((((........)))))).))...)))).....))))).......)))))))))..))))).))))......(((((...........)))))(((......)))..))))))..))))))..))))..))))))))))))))).))).))))))))).))))......)))))..))......(((((((((((((((((((((..((...((((((((((...(((.(((((.....(((..((((((((((.(((((.((((.......((((((((......((((((....))))))......))))))))...(((((..((((..((.((.((((...)))).)))).)))).))))).(((((((.(((...((((.((((..(((((((.((....)))))))))......((.((((((((..((((.(((...)))..)))).....)))))))).))..(((((((((((((.....))))).................))))))))(((.(((((((((..(((((((((((...(((((.............(((.((((..........)))).))).((((((.((((((((.................)))))))).).))))).((((....((((.....))))))))....((((((((((..((..((((..((.(((((((.......)))))))..)).((((.(((((.(..((.......)).).)))))...))))....((((..(((.((((((((((((.(.......).)))))))))............((((.((((.((((..(((((((((((((((((((.((......)).)))))..))).(((......)))....(((((((..((((...........)))))))))))...................)))))))))))..((((((........)))))).......))).).))))))))(((((((((((...((((.((((....(((((((....))))...((((((...))))))........((((((((((((((((..((.(((((((((((..(((.((((((.(((......))).)).))))))))))))))).))).))...........((((((((((.((((((((.(((((.(((((((......))))(((((.(((........))).)))))(((((..((.(((((((((.(((..(((.....)))..)))...)))))))))....)).)))))...)))..)))))))))...........)))).))))))..)))).)))))))))))))))).(((.(((((((.(((((((......((((......((((((((((...((((..(.((......)))..)))))).))))))))....(((((((..................(((((((.....)))).)))((((((((...((((........))))..))))))))((((...))))...(((((.((((((((((((((((((((....(((((.((((..(((((((((....)))).)))))..)))))))))...((((...(((((.((((((((((.((((........)))))))))))))))))))...))))..(((.((((....)))).)))((((((((.....)))............))))).((((....))))..((((((((.......))))))))...........))))))))..))))))))))))))))).....)))))))...............))))......))).))))))))))).))).....)))...))))..))))...)))))))))))....(((.((((((((((((..((.(((....))).))((((((((((((.(((.......))))))).......((((((.......))))))((((((.(((.(((((((......(((((((((....)))).))))))))))......((((((((..........((((((((.((((((.............(((.(((((((((.((.((((((....(((((((.((((((......((.((((((..(((((....))))))))))).))....((((((((((.((...........((((((((.(((((((................................))))))))))))))).........)).))))))))))...............)))))).))))))).))).))).)).))....))))))).)))(((((...(((((........)))))....)))))......(((((((((((.(..(((.........)))..).))))))))))))))))).))))))))((((((((..(((((..((((......))))..))))).....((((((.........)))))).....)))))))).....(((((((........)))))))..((((((((((((((...)))))))..)))))))........(((((((((....(((((.........))))).......))))))))).....((((((...)))))).....))))))))))))).))))))....((((.((((((...(((((........)))))........)))))).))))..........))))))))..)))))))))))))))................(((((((...)))))))))).)))..))))(((((((((...((((((((.(((((....((((((....((......))...))))))..........)))))))))))))...))))))))).........))))..)).))))))))))......))))))))))))....))))))))))))).))).((((((((((.((..................)).))))))))))...(((((((((.....(((((.......)))))......))))))))).............))))...))))...)))))))))).)))).))))).....................))))))))))...)))..))).)).))).(((.(((((((((......................)))))))....)).)))..))).)))))))))..))))))))..(((.((((((..........)))))).)))..............)))).)))))))))....)))))))
Thermodynamic Ensemble Prediction
,,((.(((((..(((...((((((((((((.((......(((.((......)).))))))))))))))))).))).))))).))||(.((((((,(((.((((((({{{((,.(.(((((((((((((((((((((,(.,...).),)))))(((((.(((((.((((((((((......)))))).(((((((((({((({{(((((((((...,..{((((((((((.(((({(.(((((((....)).)))))})..,)))).)))))))).})))..))).))))))))))}((((....)))))))).)).))))...)))).))))).)))))))))))))..}))))))).)..)).}))),})))),((((.(((((((((((((({(((((((((....)))))))|(({{{{{.{.|,((({{((((,,.{||||{||,|{|.,.,,,))),)}.})).))),).||||||.}}|((.((.((((...)))).)).))))))}))((.(((((((.(.....).))))))).))(((((((....)).)))))..))))))))).))))|((((((..{.((((((((((((((.,,,{((((((((((({...{{|||}},||{.,(.({...||,.,{{{{,|{{{....)))}.)),)))))))}))))),)))))))))))))).}.)))))),{(.|((((({......,,.))))),,)).......(((((((.((....((((((..,.{.((......)).}.,..)))).))...)).))).))))(((((((...{.(((.((((,....{((((.((((.(((((.....)))))))))..)))))))))))),.)))))))..))).)},..})).}||,.....,{{{{||,..,(({,,,{{...,,})),.}}}...{{..(((((.,....((((...((((.(((((...(((.(((((.......((((((((((.((((((((((.((((((.((((({.({({..,|||}.|||}}|{{{{,,{{(((....|||((((((((.(((((((.{{{.(((((...)))))...,.........,,,....,.,,{{,,...{{{.(((((............,,,,|}}}},)))...}}))),})))))))))))}||(({{,{(....}}},||||{({{.,,,,..{({{...,,..})}|.{{{{{...,,...((((,,,..||||..||,|}},.||||...}}}}},,|,........,{{||,,,|||......(((((((((.{{{(({.{{{..,,,...(((({.(((.((........)).))).}))))}}}.}}}....,,.)))))))))......},)})))}.,,,}})}),.,))))}...,}}||,....||,((((({........)))))).}}...,......{{{|,{{|{{|,,||....{||,|||..,|,.......,,...,.))}.}))))}}})))..|||}.....,,,..))))))..))))))..))))..))))))))))))))).))).))))))))).))))....,.))))),,))......((((((((((((((((((({,.{{{.{.((((((({{{,.,(((.{((((,{,,.(((..(({(((((({.(((((,({{...{{{{{.,{{||||,.,,,.((((((....)))))),,,...}}}}}}|{((.((..(((((.......)))}|,.}}.)))}{||{{.{{{{.|,.,,.{{{..{{{.(((({{{...,,....((({{{((((....)))))))))..}}))}|}|||,|||,..,,,|.|||,.}))),.}}|},..,.}}}}}||},||,...,,,||||||,({{.,.||{||{.{{{{{{{{{{{{{{{||,,,,|,(((.(((((((((..(((((((((((...(((((..........{{,,((.((((..........)))).)})}|(((((.((((((({{,..{...........,)))))))).).)))),.((((,..,{(((.....))))))))....((((((((((((((.(((((((((.(((((((.......))))))){(((....)))|{.((((((((..{,{,{(((..(((((((,,,{,,.(({{(,{({(,{,,(((((((((.{.......}.))))))))}.......,,{..(((((((((,(({{..((((((((((({..,{{{{.{{.,,...||,|||||,...,.|||.,,,,,)),....(((((((..((((.,.........)))))))))))...................)))))))))))...,{{{{|.....,})})))),,.....|}|.|.||||}}}}{((((((((((.,.((((.((((..{((({((((....})))...((((((...))))))........((((((((((((((((..((.(((((((((((..{((.((((({.(((......))).}).))))))))))))))).))).))..{{.....}}((((((((((.(((((((,{(((((.,,,((((......))))(((((.{{{........}}}.)))))(((((..({.(((((((((..,,..{{{.....}},...,,...)))))))))....)).)))))...}},..}))))))))...........)))).))))))..)))).)))))))))))))))).(((.(((((((.(((((((...,..{(((..,{{.(((((((({{...((((..,{((,,,...}}),,)))))).)))))))),}},{{(((({.,..........,,,...(((((((.....)))).)))((((((((...((((........))))..)))))))){{{(...}}||...{((((,{((((((((((,((((((({,{{,(((((.((((..(((((((({....}))).)))))..))))))))},{{((((,..(((((.(((((((((,{((((........))))))))))))))))))),}})))},.{((.{({,....,}}}.))}{(({{(((.....})).,,,,.,...,{||....||||....,}}}..{{{(((({.......)))))))).,,}}}}},..}))))))).}}))))))))})}))))}.....})))))||,..,.,,,......))))..,...)))}}}))))))))).))).....)})}))))))..)))).,.))))))))))}{{{{....}}}}...}}))),,))}))}}}})}}))}.,...)))))))..)))),}}....)))))))).},..((((((.......)))))).{{((((({...,{({{,,,,,.{((((((,{{.,.{||||,,||||||,,,,...|||||{{,||,,,,...,}|{((({{{{.((((((....,,,.,....({{.{(({{{{...(({({,,{.,.,.{{{||||,||{((({,,...||,{(((({..(((((....))))}}))))}.}},,.,((((((((({,{{.....,{{...((((((((.(((((((.........{{{...........,,.......)))))))))))))))|,,||....}}.})))))))))|............,})))))).))))))),)}}.)}).)},}}....)}}}}}),))){((((..,(((((........))))).}..))))}.,....(((((((((((.{..(((.........)))..,.)))))))))))}}}))).}}})))}|||}}||,,..(((((..((((......))))..))))),.}},,|||,,,||,,,.}}}|))}},.,}}))))))}}....||||||||},,..,|||||,,||,,{{((((((((((((...)))))))..))))))),,.}}},,(((((((((....{{(({.........))))).,.....)))))))))....,}}}}|},{{|||||}.,))))))),)))))))))..))))}........,.((((((((((((......(((((((((...,.,(((,..,{({.,{{{{{{{{,{{{{{..{(({{,,,,}}}}}})))).}}},..,))))))),..},,,....)))))))))..........(((((((((...((((((((,((((,,...((((((,...{,..,,,,}}...}}}}}}........}})))},))))))))...)))))))))...}},}}))))))))..,)))))))))......)))))))))))}...,))))))))))))).))).((((((((((.,,.,.......,......,.}}.))))))))))...(((((((((.....(((((.......)))))......)))))))))..,,,.))))))},,,,}))))))))),))))))))))}}}},}))}}...................,.}}}}}}}}}}...}}}.|))}.}}.}}}.{{{.{{(((((((......................)))))))....)).}))}},})}})))))),},|}})))}}}.,{({.{{{{{{...,,.,...)))}}|,},,..,,........,,)))).)))))))))....)))))}.

Transcripts

ID Sequence Length GC content
CUCCUCCUGCGCGCCCCUCCGCGCGGCCCUCGCAGGGAGUGGGGCUCGG… 4780 nt 0.4234
Summary

This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein is an important signalling protein for sarcomere assembly and has been shown to play a significant role in the exocytosis of the solute carrier family 2, facilitated glucose transporter member 4 and other proteins, possibly acting as the signal that turns on the membrane fusion machinery. Three related pseudogene have been identified on chromosomes 2 and 14. [provided by RefSeq, Aug 2011]

Forensic Context

A study in humans demonstrated that the RHOQ was downregulated during long-term weight loss (0 to 12 months) in weight losers within subcutaneous adipose tissue [Bollepalli et al. DOI:10.1038/ijo.2017.245].