| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAUACACUGUUGCUGAGUCUAGACACCAGAAGAACGUUGCAGGCGGCG… | 1257 nt | 0.5219 |
Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in positive regulation of gene expression. Predicted to be located in chromatin. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the RHOXF2B as a differentially expressed mRNA that was downregulated in heart failure compared to myocardial fibrosis in blood samples from patients, as determined by RNA sequencing [Wang et al. DOI:10.3389/fcvm.2021.664044].