| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCAGUAAGAAGCCAGCAGGGCUGGUGCUGGGGCUUCUUCUCCUGAA… | 987 nt | 0.3840 |
Enables mRNA binding activity. Involved in mRNA catabolic process and mRNA destabilization. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that dietary methylmercury exposure significantly altered hippocampal protein and RNA expression, with the RIDA being upregulated at both the protein and RNA levels in response to a high dose, indicating its role in antioxidant activity and the handling of toxic metabolites [Mellingen et al. DOI:10.1093/Mtomcs/Mfab022]. A study in mouse primary cortical astrocytes demonstrated that brief ethanol exposure significantly activated the RIDA as part of a broader transcriptional response to stress [Pignataro et al. DOI:10.1002/Brb3.125].