| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUCCGUUGUCCCUUCGCGCCCCAAACCACAUCCUGGAGCGCACUCU… | 1752 nt | 0.5320 |
This gene encodes a protein that contains a rab-interacting lysosomal protein-like domain. This protein may be involved in regulating lysosome morphology. This protein may also be a target for the Hepatitis C virus and assist in viral replication. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
A study in mice demonstrated that acute alcohol exposure during neurulation induces rapid transcriptomic changes in the rostroventral neural tube, with RILPL2, a gene involved in cilia biogenesis, being significantly up-regulated (+0.44 Log2FC) 2 hours post-exposure [Boschen et al. DOI:10.1016/J.Alcohol.2022.09.001].