| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAAAAAGGGUAACAACCCGGAAAGUAGACUCACCGUCUUGGUCUAGAG… | 1872 nt | 0.5582 |
The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that hypothermia exposure significantly increased the protein levels of the RIPK3 in the cerebral cortex, where it functions as a key mediator of necroptosis [Wang et al. DOI:10.1186/s11658-025-00772-0].