| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAACAACCAGCUGGAUCAGUUCUCACAGGAGCUACAGCGCGGAGACUG… | 720 nt | 0.4542 |
The protein encoded by this gene is a non-secretory ribonuclease that belongs to the pancreatic ribonuclease family, a subset of the ribonuclease A superfamily. The protein antimicrobial activity against viruses. [provided by RefSeq, Oct 2014]
A study in humans identified the RNASE2 as a significantly upregulated diagnostic gene marker in blood samples from patients with infective endocarditis and sepsis, demonstrating excellent diagnostic performance with an AUC > 0.781 [Chen et al. DOI:10.3389/fimmu.2023.1298041]. Separate research in humans also identified the RNASE2 as a significantly upregulated immune-related gene and potential biomarker in blood samples from burn injury patients, with its expression pattern validated by an external cohort and qRT-PCR [Niu et al. DOI:10.1093/jbcr/irad050]. A study in mice demonstrated that the RNASE2 gene (RNASE2) was downregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at a 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].