| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGCCCCUGAACCCCAGAACAACCAGCUGGAUCAGUUCUCACAGGAG… | 734 nt | 0.4796 |
The protein encoded by this gene belongs to the pancreatic ribonuclease family, a subset of the ribonuclease A superfamily. The protein exhibits antimicrobial activity against pathogenic bacteria [provided by RefSeq, Oct 2014]
A study in human sepsis patients demonstrated that the RNASE3 (RNASE3) was significantly upregulated in peripheral blood and was adversely associated with 28-day survival [Li et al. DOI:10.1515/biol-2022-0999]. A study in human burn patients identified the RNASE3 as one of 19 center genes commonly differentially expressed in blood across early-stage, middle-stage, and control group comparisons, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0].