Basic Information

Symbol
ATP6AP1
RNA class
mRNA
Alias
ATPase H+ Transporting Accessory Protein 1 VATPS1 XAP3 ATP6IP1 ATP6S1 XAP-3 Ac45 16A CF2 ATPase, H+ Transporting, Lysosomal (Vacuolar Proton Pump), Subunit 1 ATPase, H+ Transporting, Lysosomal Accessory Protein 1 V-Type Proton ATPase Subunit S1 Vacuolar Proton Pump Subunit S1 V-ATPase S1 Accessory Protein Vacuolar ATPase Subunit S1 X-Associated Protein 3 V-ATPase Ac45 Subunit V-ATPase Subunit S1 Protein XAP-3 ORF ATPase, H+ Transporting, Lysosomal Interacting Protein 1 Epididymis Secretory Sperm Binding Protein H-ATPase Subunit
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001183.6
Sequence length
2054.0 nt
GC content
0.5798

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-809.50 kcal/mol
Thermodynamic ensemble
Free energy: -843.97 kcal/mol
Frequency: 0.0000
Diversity: 607.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((....)))...((((((((((((((((((((.(((((((((((.(((((((((((((((((((.((((((.(((.((((((.(((((((.(((...((((...))))))).))))))).))))))))).)))))).(((((((..(((((((.(((((((..((((........(((.((((.....)))).))).))))...))))))).)))))))))))))).....((((......))))....((((.(((((.((((((..(((((((((((.((.((((.(((.............)))))))...)))))))))).(((((((..(((..(((..(((((((((.((.(((((((...))))))).)).)))((((((((((((.(((....((.(((((((((((((((((((((.(..(((((....)))))..).)))).((((.(((.((..((((((((..((........))..)))))).))..))((((((((..((.....))))).)))))...))).))))......((..((........))..))...)))).)))))).....)))))))))....))).....(((.((.((((.....((.(.((((....)))).).))...)))).))))).(((.(((((...((..((((.(((((((...))))))).))))..))..))))).)))...)).))))))))))....((((.........))))(((......)))..........))))))..))).)))..))))))))))..)))))).)))))))))..........)))).)))))))(((((((((((((((..((((.(.((((........)))).)))))..)))..))..))))).)))))..(((..(((((((((((((((((....(((((..((((((((.((.(((......))).))...))..))))))...(((.....))).....((((((((.....)))))))).......(((((.((..((.((.(((......))))).))..))...)))))(((((.(((........)))...))))).((((((.......).))))).))))).)))))).))))...))).))))))).))))))))....((((((((...(((((((.....)))..))))...(((((((((..((.......))...(((((((.((.....((..(((((...))).)).))...)).))))))))).))))))).))))))))(((((((((.......((((..........((((((((((((((...((((.(((((..........(((......(((((.(((((((((................((.((((.(((((((((.(((.....((((((((.((.(((.((((.(.(((((((((.(((((...........))))))))).)))).((((((.....))))))....(((((......)))))).)))))..(((((((....(((((....((((....))))))))).....)))))))))).)).))))))))))).))).)))))).)))).))((((.(((((((.....(((((.(((.(.....).))).))))).....))........))))).))))................)))))))))...))))))))..))))).)))).))))........(((....))).........)))))))))).......))))..))))).))))((((...))))....))))))...)))))))))))))))).(((((((.....((((((....))))))))))).)).((.((((((((...(((.....((((((((.((((.((((.....))))(((((.........)))))((((((((((..((((...)))))))))))))).((((((...)))))))))).)))))))))))...)))))))).)))))))))))..
Thermodynamic Ensemble Prediction
.,,,{{(((,,,{{||{,,((((((((({(((((({(({,{{((({,(({{,(((((((((((((((((({.((((((.(((.((((((.(((((((.(((...,{{{...))))))).))))))).))))))))).)))))).(((((({..(((((((.(((((((,,(((,..,{....(((,({{{.,,,,)))).}))}))}}...))))))).)))))))))))))).,...((((......))))....((((.(((((.((((((..((,((((((((.{{.((((|{{{..,...||,.,,.,||})))...)})))))))),(((((((..(((..(((..(((((((((.((.(((((((...))))))).)).)))(((((((((({{.{{.....||.(((((((((.,......((((.(..(((((....)))))..}.)))).))))))}.,||..((((((((..((........))..)))))).}}..{{((((((((..((.....)))))},)))).}}..,{.((((((...((((((((....,,((({....}}}.}}).}}|,..,}},,|{.(.(((((..(....)..))))).).}}))))))))..))))))},.,,..,.,.,..,,|,,.,....(((.(((((...((..((((.(((((((...))))))).))))..))..))))).))),,.)),))))))))))....((((.,.......)))).,|}{{({....}))}......))))))..))).)))..))))))))))..)))))).)))))))))..........}))).)))))))(((((((((({((((..((((.(.((((........)))).)))))..)))..}),.))))).)))))..(((..{(({((({(((((((({...,(((((,...{{.,,.,{|,.{(||,,.,,|||||,......),})))).}|||,....))}...,.((((((((.....))))))))..,,))}.||||}|{..{(.((,{{{......}|}}}.}}..))...}}}}.{((((.(((.{....}.)))...))))}.((((((.......).))))).))))).}))))).))},..|})}.})))))).)))))))}.},,{((((((,...{{{((((,....||||,|}}},,,((((((({(,{{{,.....,.,...(((((((,({.....{{,,((,((,..|||,}|.||,..}}.}))))))}|,|}}}|||,||||}}}}...,,.|||,}}}},}}}}|........,.|{{||||||{||,|,|,{{||,|||||,,..,.,|,,||{,.,...{((((,(((((((({................((.((((.(((((((((.(((...,{((((((((,(({(((,((({.,,,(((((((,,(((((...........))))))))).)))).((((((.....))))))....(((((......))))).,}}})},.(((((((....(((((....((((....))))))))).....))))))))))))).)}}},,},))).))).)))))).)))).))||{{,({{((({..,,.({{{{.(((,{...,,).)}|,||||},.,,{||,,......,}}}}.))),}}},.,.,,,,,,...,})))))))...))))),}},,))))).)}))})))),.,,|||,|||,..,))}}}},},,,.}}))),})))|,,,||,).}},,)))))}}}|}}|||,,.,,,,..,}}))}}}}|||}}|||}}}}||||||{{,,,,,,}}}}}||{(((|||.}}},,,,,,}},}}|{{|{|,,,,,|}}}|}}}},}.||||||||,||{{,((((.....))))}|{|{|||,...}}))})|{((((((({{..((((...)))))))))))))))|{(((({{.|}||||||||,|||,,}},,.....})))}))).)))))),))))},

Transcripts

ID Sequence Length GC content
AGUGGAGGCUGAGGCUAUGAUGGCGGCCAUGGCGACGGCUCGAGUGCGG… 2054 nt 0.5798
Summary

This gene encodes a component of a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Vacuolar ATPase (V-ATPase) is comprised of a cytosolic V1 (site of the ATP catalytic site) and a transmembrane V0 domain. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. The encoded protein of this gene may assist in the V-ATPase-mediated acidification of neuroendocrine secretory granules. This protein may also play a role in early development. [provided by RefSeq, Aug 2013]

Forensic Context

A study in primary rat microglia demonstrated that alcohol exposure significantly alters the transcriptome, downregulating numerous phagocytosis-related mRNAs including the ATP6AP1 (Atp6ap1), a component of the phagosomal H+ transporting vacuolar ATPase [Kalinin et al. DOI:10.1186/S12974-018-1184-7].