| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACAACAGCUUCUGAGCUUUGGACUAAUCACAGCCUCUGUUCUCAGCA… | 844 nt | 0.4455 |
The protein encoded by this gene is a member of the ribonuclease A superfamily and functions in the urinary tract. The protein has broad-spectrum antimicrobial activity against pathogenic bacteria. [provided by RefSeq, Nov 2014]
A study in humans demonstrated that the RNASE6 gene was upregulated as part of the antimicrobial peptides pathway in the prefrontal cortex, hippocampus, kidneys, and colon in sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that the RNASE6 mRNA was down-regulated (0.31-fold) in bone marrow cells 6 hours after a 6.5 Gy whole-body ionizing radiation exposure [Dai et al. DOI:10.1080/09553000600857389]. This finding was part of a microarray analysis identifying 103 differentially expressed genes involved in processes including DNA replication/repair, with the down-regulation of the RNASE6 indicating its role in the cellular response to radiation injury.