Basic Information

Symbol
RNASE6
RNA class
mRNA
Alias
Ribonuclease A Family Member 6 RNaseK6 RAD1 RNS6 Ribonuclease, RNase A Family, K6 Ribonuclease K6 RNase K6 Testicular Tissue Protein Li 166 Ribonuclease A Family Member K6 Ribonuclease A D1 EC 3.1.27.- EC 3.1.27.5 EC 3.1.27
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_005615.5
Sequence length
844.0 nt
GC content
0.4455

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-211.50 kcal/mol
Thermodynamic ensemble
Free energy: -230.15 kcal/mol
Frequency: 0.0000
Diversity: 256.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...((((...((((...(((((......((((.((((.((((((..((....))....)))))).)))).((((.((.((...))...))))))........))))((((((((...))))))))...))))).)))).(((((((..(((.((((((.....((((..(((((((............((((((((((((((((.....(((((((((((.(((......)))...........((((((((((.((..((..........(((...((..((((((.(((.((((((((.(((.(((((((...(((......)))...)))))((.((((....))))))(((.(((...))))))........)).))).)))).).)))))).))))))..))..)))))..)))))))))))).)))))................))))))(((.(......).))).)))).)))............))))...)))))..((((((........))))))((((((...((((((...(((...(((((.......)))))........((((......(((((((((.......((((((.(......).)))))))))))))))....)))))))...))))))...)))))))))))))))))))))))....((((((..((.(.((((((...((((..((((((.((((((....)))))).))))))...))))...))))))).))..))))))..........)))..)))))))((((((((..((....))..))))))))..........))))...)))..
Thermodynamic Ensemble Prediction
,({...,{((,..{(((((((((,,.......,{{.((((.((((((..((....}}....)))))).}))|,{(((.((.(,...||...}}...}}}},,.,,|{,(((((((((...)))))))))|.|,.......{,(((({,..,))))))..},)))}))))}}.|||||{{,...,,,|{,.....,}}..,}},........,||.((((((((((((((((((..............((((((((({,((...,..........{{(,,,((..((((((.(((.((((((((.(((.(({(((({,.{{{,...,,||)|,.,,,}}{{.((((....)))),,{((.(((...)))))),,,...,,)).))).)))).).)))))).))))))..))..}})))}.)))))))))))).......{{{{{....,,...||{({{((({{{,.....,||},,|||)}}},.....,..,,,..,}}....}}}}}.,(((((........))))}{((((((...((((((...(((...{(,,{{{{{...,)))},,,..|{{{({,..{{{{(((((((((({..{{,,,,,,.,,,....,)))))))))))))}}))}}},)))})))...))))))...))))))).,..,{((((({,,......((((((..((.,.{(((|{,,|||||..{((({{.((((((....)))))).)))))},..}}))},.})))}}}.}}..))))))....,,.)}}))),))))}.,}))))))))))))),,...{{{{{..,,......,,..)))))...,,,..

Transcripts

ID Sequence Length GC content
AGACAACAGCUUCUGAGCUUUGGACUAAUCACAGCCUCUGUUCUCAGCA… 844 nt 0.4455
Summary

The protein encoded by this gene is a member of the ribonuclease A superfamily and functions in the urinary tract. The protein has broad-spectrum antimicrobial activity against pathogenic bacteria. [provided by RefSeq, Nov 2014]

Forensic Context

A study in humans demonstrated that the RNASE6 gene was upregulated as part of the antimicrobial peptides pathway in the prefrontal cortex, hippocampus, kidneys, and colon in sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that the RNASE6 mRNA was down-regulated (0.31-fold) in bone marrow cells 6 hours after a 6.5 Gy whole-body ionizing radiation exposure [Dai et al. DOI:10.1080/09553000600857389]. This finding was part of a microarray analysis identifying 103 differentially expressed genes involved in processes including DNA replication/repair, with the down-regulation of the RNASE6 indicating its role in the cellular response to radiation injury.