| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUGGAGGGAGGCAGGGAAUCUGGCUUGAUUGGCGUGCUGAGACGCAC… | 1653 nt | 0.5469 |
This gene encodes a protein that belongs to the Rho GTPase family. Members of this family regulate the organization of the actin cytoskeleton in response to extracellular growth factors. A similar protein in rat interacts with a microtubule regulator to control axon extension. [provided by RefSeq, Apr 2014]
A study in human and rat skin demonstrated that ultraviolet-B irradiation induces significant transcriptional changes, with the RND1 being up-regulated in both species, showing a fold change of 26.5 in human and 10.0 in rat skin [Dawes et al. DOI:10.1371/journal.pone.0093338].