| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCUCUCCUUCCUGCGCCUCUUUGGUGCUGGGAGGCGGGCCGCAGGGUA… | 9135 nt | 0.4319 |
Enables ubiquitin protein ligase activity. Involved in negative regulation of signal transduction; protein ubiquitination; and ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway. Is active in endoplasmic reticulum. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the RNF115 mRNA, a gene involved in proteolysis, was relatively upregulated in adult burn animals compared to young burn animals following a severe scald injury [Song et al. DOI:10.1038/s41598-022-26040-1].