| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGAGUGCUUCGCAGCUGUCUGGGCGAGAGGCACAGCGAUGGGCUCCG… | 5573 nt | 0.3996 |
This gene encodes a novel E3 ubiquitin ligase that contains a RING finger domain in the N-terminus and three zinc-binding and one ubiquitin-interacting motif in the C-terminus. As a result of myristoylation, this protein associates with membranes and is primarily localized to intracellular membrane systems. The encoded protein may function as a positive regulator in the T-cell receptor signaling pathway. [provided by RefSeq, Mar 2012]
A study in mice demonstrated that the RNF125 was selected from a microarray analysis of heart tissue following methamphetamine administration and restraint, but quantitative RT-PCR validation did not show a statistically significant change in its mRNA expression [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001].