| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGACCUCCUGGGGAGCCGCCGCCGCCGCCCUCUCGGCCAUCGCUGCC… | 3199 nt | 0.4054 |
The protein encoded by this gene is a multi-membrane spanning protein containing a RING-H2 finger. This protein is located in the endoplasmic reticulum, and has been shown to possess ubiquitin ligase activity. This gene was found to be interrupted by a t(3:8) translocation in a family with hereditary renal and non-medulary thyroid cancer. Studies of the Drosophila counterpart suggested that this protein may interact with tumor suppressor protein VHL, as well as with COPS5/JAB1, a protein responsible for the degradation of tumor suppressor CDKN1B/P27KIP. [provided by RefSeq, Jul 2008]
A longitudinal mRNA expression analysis in post-mortem human blood samples identified the RNF139 as a protein-coding gene involved in protein demannosylation that shows an up-regulated expression pattern after death [Antiga et al. DOI:10.1038/s41598-021-96095-z].