| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGUCUGAGCUGUGGGCUGAGGCAGCGCAGCCGCUGCCGCAGGGUGCGC… | 4049 nt | 0.3653 |
The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the RNF141 was downregulated in subcutaneous adipose tissue during short-term weight loss [Bollepalli et al. DOI:10.1038/ijo.2017.245].