| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAAGCCUGCCCAACGAUCGUGGGCAGGAGGUGGUUUCUGGUUUGUUGGG… | 1117 nt | 0.5354 |
The protein encoded by this gene contains a RING finger, which is a motif known to be involved in protein-protein interactions. This protein is a membrane-bound ubiquitin ligase. It can regulate cell motility by targeting paxillin ubiquitination and altering the distribution and localization of paxillin in cytoplasm and cell focal adhesions. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the RNF5 was downregulated in ileum tissue from methamphetamine-treated animals compared to saline-treated controls and is located near SNPs associated with inflammatory bowel disease [Sun et al. DOI:10.21037/Atm-20-7741]. A study in mice demonstrated that the RNF5 mRNA was positively correlated with miR-21 levels in all subjects [Miguel-Hidalgo et al. DOI:10.1016/J.Pnpbp.2017.08.009].