Basic Information

Symbol
ROCK1
RNA class
mRNA
Alias
Rho Associated Coiled-Coil Containing Protein Kinase 1 P160ROCK Renal Carcinoma Antigen NY-REN-35 Rho-Associated Protein Kinase 1 P160 ROCK-1 EC 2.7.11.1 ROCK-I Rho-Associated, Coiled-Coil-Containing Protein Kinase 1 Rho-Associated, Coiled-Coil-Containing Protein Kinase I EC 2.7.11
Location (GRCh38)
Forensic tag(s)
Individual identification Chronological age estimation

MANE select

Transcript ID
NM_005406.3
Sequence length
9446.0 nt
GC content
0.4031

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2522.20 kcal/mol
Thermodynamic ensemble
Free energy: -2713.58 kcal/mol
Frequency: 0.0000
Diversity: 2277.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((..((((((....((((....))))(((..(((((((......))))......)))..))).(((..........)))....))))))(((...)))((..((((((((((((((((((((..(((...((((((.(((((.((((....(((((((((((.....((((((((.((((((.((((((((((...............((((.....(((((.((....))...)))))....))))...((((((((.((((((((.((....((((.....(((.(((.(((.((((((.....)).((((((.(((((((...(((.((((.((..(((((((((((..((...(((((((.(((.((((......))))...))).))))).))...)).)))))))))))..)))))).)))))))))))))))).)))))))))).)))((((...(...((((..........((((((((..........))))))))..(((((((.((.............((((.(((((.......)))))))))..(((((((((((((((((((.(((..(((.(((((.........(((((.((...)).)))))))))))))..)))))))))).))))).).))))))..)).)))))))..)))))...))))))))..)).)))).)))).))))))))(((((...))))).))))))))))((((...)))).))))))))))))))(((..((((((....))))))..))))).)))))))))((((((((...(.((........)).).)))))))).))))(((((..(((((....((((((((((((........))))).....))))))))))))....))))))))))..)))))))))..((.((((....)))).))......)))))))..)))))((((.(((.....))).))))....)))))..)))..))(((((((((...(((((((........((((.(((((((....(((.....))).....))))))))))).....(((((((........(((((...))))).........((((((.....(((((((.(((((((.(((((((.(.((((..(((((.(((((..........(((((((.(((..(((((((((...((((((.(((((...((((.(((((.((..(((...(((((..(((..((((((....((((((.(..((((((....((((....)))).....(((((((.......((........))....(((.((((((...((((((((..(((.(((.....))))))..)))))))).((((.((((((((((.(((((.(((.((((((.......))))))........(((((....)))))((((((((((((((.(((((((...))))))).)))(((((....)))))(((.((....)).)))(((((.....((((((....(((........(((((((((.....((((.(((((..((.((((((((......(((((((....(((((((...((((((((((((((((....)))))))...))))...)))))(((((((((....((........(((((((((((((((.(((.((((((((.....))))))))..))).)))).))))(((((.((((.((((((((...((.((((.........(((((...))))).......((((((((((((..(((((......)))))..))..(((((........)))))((((((((((((........)))))))..))))))))).)))).)).........((((((..(((((((((((.......(((((..((((((......)))))).)))))......(((((((..(((((((((((((.(.(((((...(((((..(((((.(((((.(((............((.((((......)))))).(((((..(((((((.((((...(((.((.(((((((((.....))).........(((((..(((((((..((((((.(((.((..................((((((.(((((........)))))(((..((((.....))))..)))...(((((......)))))((((......))))...............)))))).((.((.....)).))............................)).)))..)))))).(((..((......))..))).........)))))))..)))))))))))))...((((((...))))))........)))...)))).).))))))....)))))...............((((((((((......))))))))))...((((...((((..(((((.....)))))..)))).)))).((((((.((....))))))))))).))))))))))...))))).......))))).)))))))......)))))))..))))))).....))))))))))).........(((......))).....))).))).)))).))....)))))))))))).))))).....((((((....))))))..)))))))......))..)))))))))))))))).((((........)))).......(((.(((.(((((((.(((((((.(((((((((.((((...(((....((((.(((((....))))).))))))).((((...(((............)))....)))).......)))))))..........)))))))))))))........................(((((((.........)))))))..........((((((((.(..(((.(......((.....))......).)))))))))))).................((((..((....((((.((((.(((((((.((((......((((...............))))((((((...(((((......(((((((((((((((.....(((((...))))).....)))))))).))))))))))))......(((((((((((((((((...........(((((..(((((.(((...........(((((.......)))))..............(((((...((....(((((((....(((((....))))).....)))))))....)).......)))))................(((((...(((..(((...(((...(((........)))...))).)))..)))...)))))(((((.....(((((((....((((((((.((((.....))))..((((((........((((((((((((((......(((....((((((.............(((((((....(((((...........................................(((((((.((((((((..(((...)))..))...))))))(((...(((..(((.....)))..)))..)))......(((((........))))).)))))))...(((((((.((((((.(.(((((((((............((((((.(((((((((((.....((((.......))))......(((((((...((((.((..(((((...((((((((((...(((((((((......((((...((((((......((((((.(((((.....((((((..((((((((...))))....)))).(((((.(((((.......(((........)))(((((((....))))))).......(((((.....)))))...............((((((((..((((.((((((((((......................(((((((.(((((.((((.((..............(((((((....)))..)))).((((((......))).)))........(((((.((.......)).))))).....))..)))).))))).)))))))((((((......((((.......((((......))))..)))))))).))))))))).)))....))))...)))))))).))))).)))))..)))))).....)))))((((((((.........((((((((((((((((((..(((((((((((.(...((((((((((((..((((((((.((((((.....)))))).....(((((((((.........)))))))))..(((....))).....(((((((........)))))))..))))))))........(((........)))(((.(((((((((..((.((((........((((....((((((....((((((((((.......(((((.((((.((((..((((((..((((.((((.......))))...(((((.....((...........)).....))))).))))....))))))..)))).)))).....(((((..(((((.((.....(..((((((.(((....(.(((...(((...))).))).)))).)))))).).....)).)))))..)))))....((((((((((....(((((((.(((((...((((..(.((((..(((..((((((((((((((..((((((((.(((((((((..((((.........(((((((...)))))))..........))))...))))...(((....)))...(((((.(......).)))))((.(((((((.(((((((.(((..((((((((((((((..(((........))).))))))))................)))))).)))...)))).))).))))))).))..((((......))))..........)))))..))))).)))..))))))).(((........))).((((((((((......((((((((((((..(((.((((...(((((((...(((((((((((((((((((.(.((((((((....))))))))........((((((...))))))(((......)))(((((((((((((((((.(((.((((....)))).)))))))))....(.((((......)))).)((((((....))))))....))))))))))).(((((((...((((.((...(((((((....)))))))...)).)).))..........)))))))...).)))))))))))).))))((((((((((........))))))))))...............)))..)))))))...)))))))..................))))))))))))....))))).((.(((((....))))).))........)))))...)))))))))).)))).)..)))).))))).)))))))...)))))).))))..))))).......))))))).........)))....))))))....))))........)))).)).....))))))))).))).)).)))))))))).).)))))).)).)))...(((((((....)))).)))....(((((...(((((....((((((((.(.(((.(((((((((((((.((((.((((..((.(((((((.(((...))).))))))).))...))))))))...))).))))))).))).))).).))))))))))))).)))))......((((..(((..(((.(((..((((.......(((((..((((((((..((((((((((......)))))).))))..))))))))....(((((((....((((((....(((((((((.....)))))))))..)))))).....)))))))...))))).....)))).........(((((((.......))).))))...((((.(((((...........................))))).))))))))))..)))..))))((((((((.((...((((((((((((((((((((..............(((.((((((((((...(((((((((......))))))))).......((((((((((.....)))))))))).....................)))).))))))..)))....(((....)))((.((......)).))))))))))))..))))).....)))))...))))))))))...))))))))))))))).)))(((((((((((........))))))))))).............))))))))((((((((((.((((............)))))))))))))))))))))))))).))))....))))))))).))))).......(((.....))).)))))......)))))..))))))...)))))))((((((((((......((((((..((.((((((...))))))..)).))))))...(((((......))))).)))))..))))).....))))))))))))))))).((((.........))))..))))))))))))))))..........)))))))...)))))......)))))))...((((((..(((((((...(((((...)))))...))))))))))))))))))).)))))))))).)))))))...((((((..((((...............((((..........))))....(((....(((.((((((.((((..(((((...........)))))..)))))))..))).)))..)))......))))..)))))).((((.(((..(((((.(((((((.(....((((((..((.((((((..(((((......)))))..)))))).)).))))..)).....).))))))))))))))).))))...))))))..))))))))....))))))).....)))))..)))))))).)))))((((.........))))...(((((((((((((((......)))....................((((((((((.((..(((((...((((((((((((.....(((....(((..(((((((((......)))...................((((.....)))).))))))..))))))))))))))))))((......)).......)))))..))...))).)))))))(((.(((((((.......))............))))))))))))))))))))..((((.((.....))))))......)))))))))))))))))........)))))).............)))).)).))))).)))).))))....)).)))))))))))))))))((((((.....)).)))).......))))))))))))))).))....))))).)))))))))))))...)))..))))))..(((((((((..(..((((((((......(((.....))).................((((((((((((((.((((.(((((..((((.(((((...((.((..((....)))).))...))).)).))))((((....)))).((((((((((.(((((((((.((....((((..(((((........(((((((.......)))))))......(((((............)))))..........(((((((.((...................)))))))))(((((((((........)))))))))..................))))).))))......((((.....))))(((((((((.(((...((((........(((.((((((.((((.((((((((((((........((((.......)))))))))..)))..)))).))))..)))))))))........))))))).)))))....))))...............(((.....(((((((..((((((.....(((((((.((((....((....((........))....)).....)))).)))))))......))))))..)))))))...))).((((((...)))))).)))))))))))))))))))))((((((((.((....)))).))))))....)))))))))..)))....))).)))))))).))))))))..)..)))))))))......((((.....))))....)))))......((((((((((((((((((((((......)).))))((((((..(((....((.(.((((....)))).).)).....)))..))))))(((((......)))))...(((((.((......)).))))).............................)))))))))).....))))))......))))......)))))))((((((.....((((((((((((.................))))))))))))...))))))....))).))))).)))))))))).))))...(((((...)))))..........)))))).))))))))))..))))))..)))))))....))))))..))).))))).....(((((((((((((.......)))))).)))))))...((..(((..((((.......))))..)))..)).........)))..)))))))))))((((.(((((.((((((.....(((((.....)))))....)))))).))))))))).........)))))))))))..)))))))))....))).))))))).(((((..........)))))(((....))).(((((.......)))))))))))))))........))))).)))))))))))))).))).))))......))))))))))))).....)))))))..)))))))))..........((((((((((((((.((((..((......))..)))))))))))).....))))))((((((((((.(((((.....))))).(((((((((((((((.(((......(((((((.......))))))).((((((((.....((((......)))).....))))))))))).)).)))).....)))))))))........((((((.......))))))(((((......)))))..............))))))))))((((((((...((((.......)))))))))))))))..)))).......((((((....))))))
Thermodynamic Ensemble Prediction
((((.(((.{((((((.,,{({{(,,.,|}}},||,.(((((((......))))......}}}..,,,.{{{........,,))),..,))))))|{{...}}}((..(((((((((((((((((((({{((({({(,,,,,.,,,((((((((((.(((((((((((.....(((((((({((((((,((((((((((...............{{.{,,...(((((.{{....}),..)))))..,,||}....((((((((.((((((((.((..,,((((.....(((.(((.(({{((((((.....)).((((((.(((((((...(((.((((.((..(((((((((((..((...(((((((.(((.((((......))))...))).))))).))...)).)))))))))))..)))))).)))))))))))))))).}))))))))).)))((((...{...((((..........((((((((..........)))))))).,.((((((.((.............((((.(((((.......))))))))),.(((((((((((((((((({{(((..({({(((((.{{...{{.((,,,..}}.}),.},))}))))))))..))))))))))},)))).).))))))..)).)))))))}.)))),...)))))))),.)).)))).)))).)))))))){{|||,..})))).))))))))))|(((...)))}.))))))))))))))(((..((((((....))))))..))))).)))))))))((((((((...(,((.,,.....}).}.)))))))).,,.|{,,{,..,,|||..,.||||||||||||}}...}}})),||{{{{.||||,|||}},...}}),),))),,)}})))}}}}.}..((.((((....)))).))......)))))))..)))))((((.(((.....))).))))....)))))..)))..))(((((((((.,.(((((((({,.....((({{(((((((....{{{.....})}.....))))))))))).....{((((((,.......{{{((,..}}}}}......,..{(((({...,,{{{{(({.(((((((.(((((((.(.((((..{((((.(((((.,,,.,,,..(((((((.(((..(((((((((...((((((.(((((...{(((.{,{{{{{{{,(({...(((((..(((..((((((....((((({,(..((((((....((((....)))).,...(((((((,......((........))....{((.((((((...((((((((..(((.(((.....))))))..)))))))).{(((.((((((((((.(((((.,{{,((((((.......))))))}..,,...,{(((,,,,}}}})||{{|||.{(({{,,{{{(({{...}}}}|||...{(((((....)))))|||.|{....},{||,(((((.....((((((....(({..{,....(((((((((.....((((.(((((.,(,,((((((((......(((((((....((((((({..((((((((((((((((....)))))))...))))...)))))(((((((((.,{.((........(((((((((((((((.(((,((((((((.....))))))))}.))).)))).)))){((((.((({,((((((((...((.((((.........{((((...))))}...,|,,|,{{{{{{{{((..(((((......)))))..})..{{{{{........}))}}(((({(((((((........)))))))..})))))))).)))}..}......,,....{{,..(((((((((((.......(((((..((((((......)))))).)))))......(((((((..(((((((((((((.{.(((((...(((((..(((((.(((((.(({.........{{{((.((((......))))}}.|||||..(((((((,((((,,.{({.((.((({{{{{{|,,,,|||.........{{{{{,,(((({((,,(((((,,,...{{{,...,,........{{.((((((..,((,.....,{{(((|{((,..{{||,,,..}}}}..})}.,,||||{......)||||((((......)))))}},......,,...)))))),,..||......{{{{...{,,.....,...,,......,,......}}}.}))..))}},...,{...,,.},..}}}.,..}}}..}}}}}||,.}}}))})),,}},...{(((((...))))))........}}}...}}},.},,,}))),...}}}}................((((((((((......))))))))))...|{{{...{(((..(((((.....)))))..)))}.,}}},{{{{||,||,,,})))))))}))).))))))))))...))))).......))))).)))))))}.....,))))))..))))))).....))))))))))),,.......|,|||....,)),.,..}}},},..)))).)).,..)))))))))))).})))}.....((((((....})))))..)))))))......)}..}))))))))))}))}}.((((........)))).......{((.(((.(((((((.{((((((.((((({(((.{({({..,(({...,,.{.{((({....|}|||{|||,,,}}||||........{{{{......,,.....)))}.......,}|||},.......}}}))))))))))))}..............,,,...{{{.(((((((.........))))))),,,.......((((((({,{..(((.{...,..{{.....}}...,..,.)))}))))))))........,.......,||{(,,((....((((.((((.(((((((.((({......{(((...............}|}}{{{{{{...(((({.....,(((((((((((((((.....(((((...))))).....))))))))}}}))))))))))....,,,((((((((((((((((.....,,....(((((..((((,,(((..,....,...(((((.......)))))..........,{,,(({({,{,{{....(((((((....(((({....))))).....)))))))....|},,..,..}}}||.,,.............(((((,{.(((..(((...({(.,,{{{......,||||,,,))).)))|.}}}.,.}))}},((((,....{((((((..{{((((((((.{{{(.,,,,||}}.,|||||{,......,{((((({(((((({......,{{,...{{{{((,..,,,,,...,{,............{{{....,,,............,......................{((((((({((((((((..(((...)))..))...))))))|{(...(((..(((.....)))..)))..}},.|||,.{{(({..,,....},,,}.}})}}}}..}})}||||.{{{,,|,|.||||||{{{............((((((.(((((((((((.....((((.......))))......,((((((...((({{((..(((((..,((((((((((...(((((((({......((((..,((((,{......{{(({{.(((((.....((((((..{{{{((((...)))).,,.,,,,.{((((.(((((.......(((........)))(((((({....})))))).......(((((.....)))))......,........((((((((.,((((.{(((((((((..................,...(((((((.(((((.((((.((..............{((,(((,..,|}|.,||,..((((((......)))},))...,|,..{|{||.||,,,.,,,.},)})}}.....))..)))).))))).)))))))(((({{.....,{{((.......,((,...,,.})))..}))))))).)))))))))}}))....)))),,.)))))))).))))).)))))..)))))).....)))))((((((((,,..,,,..{{{(((((((((((((((..,,(({(,,(((((,..((((((((((((..((((((((.((((((.....)))))).....(((((((((.........)))))))))..(((....))).....(((((((........)))))))..)))))))).,,,,...(((........))),||,{((((((((..((.((((........((((....((((((....(((,,,(((,..{({{(((((,.{(((,{{(({(((({,{,,(({,.((((.......))))...{{{({..,..((...........))..,,.})))}.,}}}.....|(((((.(((((((.(((((((((.((((((((.(((((({...((((.{{....}}.)))}......(((((..(((((.{..{.(((({.,{((((((..,,,,,|,.}}}}}},..........((((.......)))).....{{{{{{(,,.,{{{{,,,},,((((({(((((((((((....)))))))}}))){(.((((((({{{.,{(((({...,||}}||,,.........,,,},,}|,....,|},,.,}})))))))))).}}....,.,}},.((.(((((((.(((((((.(((..((((((((((((((..(((........))).))))))))..............,,)))))).)))...))))},)).))))))).))..((((......))))..,{{{{{{{{.{{{,{{|||{{,{{.||||}}|||||,..,......,}}}),}}}}},))}}}}}}})))))..,})})))})))))}})))))}..}))))).)))))............))))))).,,))))))),,,,......,,{(({{{...)))))}....))))))))))))))))....)))))}||||||||||,,||{{{{|...)))))}}.|,|,,{......}}}}.,((((((....))))))....,{{{{((((((.,,....,,.))))))}|,}}|||||||,,,,,||||},...))}}|.((((((((.(({{{.{((((.(((((((,{(({,.,,,{((({{,,||||{{(((,..,|||}}}}}},.,,,....})),,}.,})))}}.})))))}((((......{,,......(((((((...(((((((...((({,({...})))))...)))))))....))))))).......}))...)))))))))}}}),)))))))).||.......,,}})}}},,|,|||,,|||,......})))}}}},,,,,}}}})).,..))))))....))))........)))).}}.....))))))))}.}}}.)),}))))))))){{{.,,,,.})).{{{{{(((,{(((....)))}.|||....{{{{{...(({{(,...((((((((.(.(((.(((((((((((((.((((.((((..{,.(((((((.(((...})).))))))).},...))))))))...))),})))))).))).))).).))))))))}}})).}}))).,.,..,,||,.((({{{(({((,.,{((({{{{.{,({{{{..((((((((..{(((((((((......)))))).)))}..)))))))}....(((((({.,,.((((((....(((((((((,...,)))))))))..))))))..}},))))))),,.}}|||,{{{{||||,,,{,....,|||||,,,,..,,|||,.,,,...{(({.(((({.,..,,.,.,,........,}}.....))))).)))))))))),,))}.,))))||,{||,.|||}|.|,|||||(({((((((((((...,,,.,{,,...{{{.{{{{{{{{{(...(((((((((......))))))))),,.....((((((((((.....)))))))))}.....................))))}})))))..))|{{{{{{{....,|}||.,|......)),))))))))))))..}))))}}}}}),,))}))),,,},))))...))))))))))))))).,)|(((((((((((........)))))))))))},,,.....,}..))))))))(((((((((,{((({...,.....,..}))))))))))))))))))),))))).))))..,.})))))))).))))).......(((.....))).)))))...,..)))))..))))))...))))))|((((((((((......((((((..{{.((((({...})))))..,,.))))))...(((((......))))).)))))..))))),....))))))))))))))))).{(({......,,.)))}.{||||||||||,|||||........}})))))))}}})))}}....,,})))))),..((((((.,(((((((...(((((...)))))...)))))))))))))}))))),}})))))))).))))))),}|||{|{||,|||{|||......,,....{(({|,,.......}}}},...,((.,,.(((.((((((.((((..(((((.,.........)))))..)))))))..))).))).,)))..,||.})}},}}}|},..{(((.(((..{((((.(((((((.,....{{({{{,.({.{(((((..(((((,.....)))))..)))))).)).}}),.,}},},,,}.)))))))))))}))).)))}...}})}}),,)))))))).,|.)))))))....,})))),.)))))))).)))))(((({{....,}.))))...(((((((((((({(((,...,|||.{{({((.....,,.{|{{,.,,}))}....,}....}}}}}}((((((((((((.....,{{..,,{,{.,,{{,{{({(((,.,,{||||}|,|}..,,,,.,,,..((((.....)))),,}}},),.)))))))))))))))))),....,.{||.{{{...{{{{{....})}))),)})))},(((.(((((.........||...,,.......))))))))))))))))))))..{(((.((.....)))))),,,...))))))))))))))))),....,},)))))}.....,.......}))).)).))))).)))).))))....)).))))))))))))))))}((((((.....)).)))),.))...))))))))))))))},),.,,.))))).))))))))))))),,.}}}..))))))..,|||||,||},({{((({{(((......,,,}}}..)))}}}}........,{,,.((((((((((((((.((((.(((((..({{(,(({{(,,.{(.{,..{{..,,))}}.,,..,|||.}}.|}}},{{|....)))).(((((((({{{((((((((({((..,,{,{{..,,|||........((((({{(,....,)))))))....,,(((((............)))))..........,,,{{{{{{{........,,,{{......}))))|||,(((((((((........))))))))).,,,.,,||,.,,{|...,,}}}||||}..{{{.(((({...,)))),|||(((((.(({...((((,{,,,..,(((.((((((.((((.((({{(({((((,,,,.,..|{||,,,,,.,,,},))))}..))}..}))).)))}..}))))}})).}..,...)))))}}.}))))....,,}},,,,..,,||||,||,,,..,,.{((((((..((((({..,,.(((((((.((({....({....({........))...,)},|...}))).)))))))......})))))..))))))},,,||,.,{{|||,,.))))},.)))))))))))))))))))))((((((((.((....)))).))))))....)))))))))..)))....))).)))))))).|||}}},,..,}})||||||||....,,((((.....)))).,,})))))}}....{{(((((((((((((((((({({,...,)).)))}((((((..{(({...({.{.((((....)))).|.}}...},)||..}})))){{{{{......)))))...(((((.((......}).))))),,,.....,,,..................)))))))))),....})}}}}..||,,.,,,,,...,}},|,||{{{{||,,,..(((((((((((({{............}}.))))))))))))...)))))}....},,.))))).)))))))))).))))...(((((...}))))........},)))))).)}))))))))}}))))))..)))))))....))))))..))).)))))},},.(((((((((((((.......)))))),})))))).,.,,..{{{..((((.......))))..}}}..},...|,,{{||||,,|||,,,,})))||||,|||||.((((((,{,..(((((.....))))).,..)))))).)))}}}))}.........)))))))))))..}))))))))....))).))))))).{((((.,........))))}{{{....})}.{((({....,..)}))})))))))))}...,,...)))),.)))))))))))))).})|,|}},.,},,,)))})))))))))},,..})))))).,))))))))).........{((((((((((((((.((((..,,......}}..))))))))))))....,))))))|(((((((((.(((((.....)))))...(({(((((,..,,.,,.....,.(((((((.......)))))))..(((((((.,...((((((((...((((((....{,,.{(({{....})))}.,}},,,))))))...))))...)))).),...})))))).....)))}}}}.|{{........,.,)},)))))))))}((((((((...((((.......)))))))))))))))..)))).......{(((({....}))))}

Transcripts

ID Sequence Length GC content
AGUCUGCCCCGGCGGUCUCCGUUUGUUUGAACAGGAAGGCGGACAUAUU… 9446 nt 0.4031
Summary

This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]

Forensic Context

A study in humans demonstrated that the ROCK1 is highly expressed in vascular smooth muscle cells of the corpus cavernosum and is implicated in smooth muscle contraction via the Rho/ROCK pathway [Zhao et al. DOI:10.1038/s41467-022-31950-9]. In a separate human study of older monozygotic twins, the ROCK1 was identified as a target gene regulated by miR-148a, a microRNA associated with longitudinal phenotypic decline in physical functioning and frailty [La Grotta et al. DOI:10.1016/j.mad.2025.112099].