| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUGCCCCGGCGGUCUCCGUUUGUUUGAACAGGAAGGCGGACAUAUU… | 9446 nt | 0.4031 |
This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
A study in humans demonstrated that the ROCK1 is highly expressed in vascular smooth muscle cells of the corpus cavernosum and is implicated in smooth muscle contraction via the Rho/ROCK pathway [Zhao et al. DOI:10.1038/s41467-022-31950-9]. In a separate human study of older monozygotic twins, the ROCK1 was identified as a target gene regulated by miR-148a, a microRNA associated with longitudinal phenotypic decline in physical functioning and frailty [La Grotta et al. DOI:10.1016/j.mad.2025.112099].