| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCAGAAGCACUGGGGGAGAGAGCUAGGUGCAGAGCUUCAGGCUGAG… | 3055 nt | 0.5610 | |
| AGCCAGGGCAGCCAGGACGGCACCAAGGGAGCUGCCCCAUGGACAGGGC… | 2996 nt | 0.5594 |
The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that long-term methamphetamine consumption induced heart failure, characterized by decreased ejection fraction and myocardial contractility, and identified the RORC as a candidate biomarker and an important hub gene in the protein-protein interaction network, with its differential mRNA expression confirmed by qRT-PCR in left ventricular tissue [Zhang et al. DOI:10.1016/J.Taap.2022.116172].