| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUUCUAAGAACUAACCUUUAGUCACUGGGUGACUUUAUGGGAGUAA… | 8457 nt | 0.4171 | |
| GCACUUCUAAGAACUAACCUUUAGUCACUGGGUGACUUUAUGGGAGUAA… | 8451 nt | 0.4169 | |
| GCACUUCUAAGAACUAACCUUUAGUCACUGGGUGACUUUAUGGGAGUAA… | 8469 nt | 0.4165 |
This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008] CIViC Summary for ROS1 Gene ROS1 is a receptor tyrosine kinase that is frequently involved in genetic rearrangement in a variety of human cancers (e.g. NSCLC, gastric cancer, ovarian cancer, cholangiocarcinoma, colorectal cancer, angiosarcoma...). The resulting fusion protein harbors the constitutively active ROS1 kinase domain and drives cellular proliferation (Davies et. al.). In NSCLC about 1% harbor a ROS1 rearrangement. These patients are predominantely female and have a lower T-stage (Warth et. al.). Treatment with crizotinib leads to a reported objective response rate of appr. 70% and a median duration of response of 18 months (Shaw et. al.). Resistance mechanisms to crizotinib have been described and involve mutations in the kinase domain. More selective inhibitors of ROS1 might overcome this resistance (Davare et. al.).
A study in mice demonstrated that the ROS1 (Ros1 proto-oncogene) was identified as a significantly downregulated RNA marker in lung tissue following hypothermia-induced death, showing a 0.402-fold reduction in expression compared to controls [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. This finding, derived from DNA microarray analysis, establishes the ROS1 as a candidate forensic biomarker for hypothermia within the investigated murine model.