| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAAAUGGACCAUCUGUUGGAGCUCAGGAGGCUGGGCUCCUGCCCAAGG… | 8014 nt | 0.6180 |
This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, and two C-terminal large repetitive regions, both of which contain a high percentage of glutamine and glutamic acid residues. This protein is a retinal-specific protein. Its exact length varies among individuals due to the presence of a 16aa repeat in the first C-terminal repetitive region. The 16aa repeat is encoded by the highly polymorphic 48-bp repeat, and 1-6 copies of the 16aa repeat have been identified in normal individuals. The current reference sequence shown here has a single copy of the 16aa repeat. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Mutations in this gene cause occult macular dystrophy (OMD). [provided by RefSeq, Sep 2010]
No relevant information is available at the moment.