Basic Information

Symbol
RP1L1
RNA class
mRNA
Alias
RP1 Like 1 DCDC4B Retinitis Pigmentosa 1-Like 1 Protein Doublecortin Domain Containing 4B Retinitis Pigmentosa 1 Like 1 Retinitis Pigmentosa 1-Like 1 OCMD RP88
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_178857.6
Sequence length
8014.0 nt
GC content
0.6180

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3439.60 kcal/mol
Thermodynamic ensemble
Free energy: -3570.22 kcal/mol
Frequency: 0.0000
Diversity: 1864.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((..(((((.(((..((((....((((((((((((((((..((((((((((((....((((((........))))))))))))(((.((......((((.(.((((((((((((...((((((.(((((....((..(((.(((((((.((((((......))...))))..))))))))))..))..))))).))).)))...))))))).))))).))))))).)))(((((.((..(((((....)))...............))..)))))))..(((((..(((((..(((.((.(...((((((((((((((((((((((((..((((((((((.(((.((((((((.((((.....((((.(((((.......)))))))))...)))).((((((.(((((((((.......)))).))((((((.....((((.((((((((.(((..(.((.((((((.....(((((((.......(((((((.(((((((((..(.(((((.(((((((......((.(.((((((.....((((((.......((((((((((((((((((((...((((((((..(((.(((((((.(((((((((((((((((((((((.......(((((...)))))(((((((.(((..((((..((.....)).(((((..(((..((((((.((..(.((......)))..))))))))..(((.(((((.(((((.......((.((.....))))......))))).)))))))).......)))..)))))..(((......)))...))))..))).)))))))))))))))))..((....((((((.(((((((.(....(((.((.((.(.(((((......))))))))))))).).)))))))))))))...))....(((((((((..((((((((..(((((..(((..(.....)..)))......))).))..)))))..................)))..)))))))))..(((((..((.(((((.....))))))))))))..))).((((((.((...)))))))).....))))))))))..........(((((((((((.(((.(((((.(...((....))...))))))...))).)))))))))))((((((.((.((..............((((.((....)).))))....(((((((((((((........))))).(((((((((..((((......)))).))).)))...)))))))))))(((((....))))))))).))))))..((((....))))...))))))).(((((.((((((..((.....))))).))))))))))))))))))))))))))(((((((......)))))))((((...(((.((.((((((((..((((..((((..(((.....)))..))))..............)))).....)))))))).)).)))))))..)))).))))))))).....(((((((((...(((...(((((((((((((((((((((...)))))))....((.((....)).))...))))))..)))).))))..)))..((((((..(.(.(((((((..((((((((.......))))))))..((((.((....((((((.....)))))))).))))((((((((((.(......).)))))))).)).....((((((((......((((....))))((((((.(((....(((((((.((((((((((((((........).))))))(((((.((((((((((............))))..))))))....)))))))))).)).)))).)))......((((.....)))).(((((((((....)))))))))......))).))))))...)))).)))).))))))).).)..))))))..)))))))))))))))(((..((((((...(((..(((........)))..))).))))))...))).)))))).).))))))))).)))).).)...))))).)))).))((((((..((((((((((((((((.(((((((((((..((.((((((((((((...(((..((((((((((.(((.((((((((......(((......)))..))).......(((((((((((((.((((.(((((..((((....))))..((((((((......))).)))))....((....))..........((((.....(((((((........((..(((((....(((((((..((((......(((.(((.....(((((.((((.((...((((((..((((...)))).))))))....(((((((((.((((((...(((((((((((.(((((((((((((((((((....)))))))............((((.(((((((((.((((.(((...((((((((((..(((.(((.(..((..((((((((((..((((((....(((((.(.((((.((.((.(......))))).))))...).)))))...)))))).((((((((((........(((((((((((((.((((.((((...((((...((....))..))))...))))..)))).)))))))).)))))))))).)))))((((((....))))))..(((..((((.((((((((.(((((((((((((((......(((((((.((((....))))))).)))).)))))))))))(((((...)))))......(((((.(((((((....))))))).).))))....))))))))))))))))..))).((((((......((((((((......((((((..((((((...)).((((((((((((....((((((.(((((((((((((((((.((((.(((((((...(......).)))))..)).))))..))))))).))))))....(((((......))))).....((((((...))))))..))).)..)).))))..))))))))).))).(((((((((((((((.(((((.....(((.(.((((.((..((((((((......)))))....(((...(((((((...))))))).))).........(((((((((((((.(((((.(((((((.((((((.((((....((.((((((....)))))).))...)))).)))..)))..)))))))(((((....))))).(((.(((..((((((((........).))).).)))..))))))((((((.((((...)))).)))))).....((((((((((((((....((((((((((((.((((((((..(((((((((((((((((((((..((...(((.((((((.(((...))).((.(((((..((((((.((.(((((((((((((((((......))))))(((..((((((((.((((((((......))..)))))).))))..))))...))).....))))..))))))))))))).)).))))).)))))))))))....))..)))))))..)))))))......((((....)))))))))))..(((.((...))..)))....))))))))))........)))))))))).((.((((((((..((((....)))).......(((((......)))))((((.((((((((((((..((((.....))))..((((((((..((((...))))((((((((.((.((((.................))))))))))))))......)))).)))).((((((.(((((((..(((...((.((((((((((.((......)).)))...))))))).))...))).)))))))...)))))).))))))))))))))))....))).)))))))...))))))..(((((..(((((....))))))))))..))))))))..)).))).)).)))))))))))...))).)).)))).)))).....))))))))).)).)))))))))..))))..)))))).((((((.((((......))))(((........)))..((((......))))....................)))))).......)))))))).(((..((....))..)))........))))))....))))))))))..))..).))).)))..)))))))))).)))..)))).)).............((((((........(((......))).........)))))).......)))))))))))...)))))).......)))))).).))))))..........(((((((((...)))))))))...))))..((((((((.......))))..)))).....))))..)).)))))))))..((((((((.(((((..(((((((.......(.((((.(((((...(((((............)))))((((((((...(((((((((......)))))).......(((((((..((((((.(((.((((...))))..))).....((((.......))))..(((((((((.((((...((......))..)))).)...))))))))......((((((....(.(((((((((((...((.....))(((((((((.(((.((((((((((((((((((.((.(((((((((((((.((.((..(((.(((((((((.((.......)).))))....((((.....))))((((..((....))))))(((((((((.(.((.((((..((((.(((((.......))))).)).))....)))))))))))).)))).(((.(((......))).)))......))))).)))..).).)))))....)))))))))).))..)))))........((.((((((...))))))))))))))))))))).))))))))).))).(((((((((.(.(((....))).).)))))...((((((.(((((((((.(((((.(((((((((((((((..((((((((((...))))))).)))...)))).)))....)))).))))..)).))).)..)))))))).))))))..(((......)))))))).))))))))))..).......)).))))..(((((((...(....)...)))))))..((((((((.(......).))))))))..((((((......))))))......))))).)......))).))))..))).))))))))((((((((((.((.(((...(((.(((((.........(..((.(((((....))).)).))..))))))))))))))..)))))))))).....)))))..)))).)..........))))))).....(((....))).......)))))...))))))))(((........))).....(((......)))..(((....)))....((.((....)).)))))))).)))))))))))..))))..))))))).....)))))..))...)))))))....))))))))).)))))))))..)))))))).))))).)))))))).)))))..))))))).((........)).(((.....(((((((...........)))))))....)))..))))))))))..)).)))))............((((((.(.((((........))))).)).))))...(((....))).(((...(((....))).....))).)))).)))...)))))))))))))))))))...............))))))))))))...)))))))).)..))))))......))))).))))....))))))......)))..))))))............))))...)))).))).))))).)))))..).)))))))....))).))).))))........))))))...).)).)))...)).)))....)))))(((.(.....).)))...........))))))..).))).....))).))))))))).))))))).)))))....((((((((.((((....(((....)))...(((....(((....))).)))...(((....))).....)))))))).))))..((..((((.(((((((((((((((((((..((...((((((((((.((.((.(((..(((((..((((((..(((.((((((...(((((((((((.(((((......((((((((((((((((((.(.......(((...(((.((....)).)))..)))....(((((((...(((.(.(((...(((((..((.((.((..(((((((.((((..(((..((((............(((((.((.(((....(((....))).(((..........)))......))))).).)))).....((.((((......((.....)).....))))))...))))...)))..))))(((((....((....(((......)))...)))))))..(((....)))...(((.(((....(((......)))...))).)))..((((.(((((((((....((....(((......)))...)))))))....((.(((((.(((..........)))...).))))))...(((....(((....))).)))..........(((...(.((((((.....(((....((.(((((.(((..........)))...).)))))).....)))....)).))))).)))...(((....))).......((((...((((...(((....)))))))....(((....(((...)))....)))......))))...((((((((..(((........)))..)))))))).((((.(((....))).))))..((((....)))).))))..))))..))))))).)).(((((.((...)).))))).....)).)))))))...))).)))).)))))))..).))))))))))(((((((((((((((((((((..(((.....))).........((.(((((..(((((((((((((((..((((..((((.((((((.......))))..)))).)).((......))(((....))).(((((.....))))).((((((((...((((..((...)).))))))))))))..((.((((....)))).))...))))..)))).))))..((((.((((((((((...))))))...))))))))((((..((((..((((((((((((((.((((((....((((((.((......))...))))))((((((((.(.....(((......((((((....(((((((...)))))))....))))))(((((((.....)))))))........(((((((((.((((((((((....))..)).)))))).)).....))))))).))).....).))))))))....(((.((.(((((...)))))..))..)))..)))))).)))))))...)))))))...)))))))).))))))).......))))).))(((((((..(((((((((((((((((.....))))).)))).)))))))).))))))).)))))))))))))...))))))))))))))))))))).)))))))))))...)))))).)))))))))..)))))..))))).)).)))))))))).))..)))))))))).))))).....(((((((((((((((.((...((((((.......)))))).)).)))))))))))))))....))))))))..)))))..
Thermodynamic Ensemble Prediction
.....(((,.(((((.{((,.((((....((((((((((((((((..((((((((((((....((((((........)))))))))))),.((((.{(({((((((((((((((((((((.,,{{,{{{,|||,|}}.}||.,|(({((((,,({(({,,,..,,}}}))),))),..))))))))),..))}}))))}.|||.}||,,.}}|||||.|||.{{(((((.((({.(((((.({..({(((,...|}}.,.......|,....}}..}}}}}))..,{(({.,(((((,.(((.((.{...((((((((((((((((((((((({.,((((((((((.(((.(((({(,(,{(({..,..((((.(((((,....,.)))))))))...}})}.{|{{((,{((((((((.......)))).))((((((..{..((((.((((((((.(((.,{.((,((((((.....(((((({,,,,,,((((((((.(((((((((..(.(((((.(((((((......((.(,((((((.....(((((,.....({{(((((((((((((((((({..,((((((((.,(((.(((((((.(((((((((((((((((((((((.......(((((...))))){((((((.(((..((((..((,.({,{{.(((((..(((..((((((,((..(.({......})}.,)}))))))..(((.(((({.((({(.,,{,...,.,,.,,}}}}}}...,},})))).}))))))).......}))..)))))..||,.,},.})})...))))..))).))))))}))))))))))..((....((((((.{((((((,(....{((.((.((.{.(((((......)))))}))))))),).)))))))))))))...))....(((((((((..((((((((..((,{{,.(((.,,.....)..)))......))).))..)))))..................)))..)))))))))..(((((..(,{(((((.....))))))))))))..))).((((((.({...)))))))).....))))))))))..........(((((((((((.(((.(((((.{,..((....)).,.,)))))...))).)))))))))))((((((.((.((,.............((((.({....}).))))....(((((((((((((,.......})))},|||||({((..{{{{{{{{..,,,)))).,})},},)).)))))))){((((....))))))))).)))))).{((((....))))}..))))))).(((((.((({(({,((.....)}))).))))))))))))))))))))))))))(((((((......)))))))((((,..(((.((.((((((((..(((({,((((..(((.....)))..)))).}}...........)))).....)))))))).)).)))))))..)))).)))))))))).,.,(((((((((.,,(({...(((((((((((((((((((((...)))))))....((.((....)).))...))))))..)))).))))..)}),,((((((..(.(.(((((((..((((((((.......)))))))),{((((((({,..((((((.....)))))),,.,,,|((((((((((,(....,,}.}))))))).)),....(((((({(,.{{{.((((....}}}|{|((((.({(....{{{{{{{.{({(((((((((((........).))))))(((((.((((((((((............)))),.))))))....)))))))))).)),)))),)}}......||||}}...))))}{((((((((....))))))))|{{|..{||..,,))),.}.)))}.)))),))))))).).)..))))))..)))))))))))))))((({.((((((..,((,..(((........)))..})).)))))).,,))).)))))).}.}}))))))).)))).).)...))))),,))).))((((((..{(((((((((((((((.(((((((((((..((.((((((((((((,{{(((..((((((((((,(({.((((({((,.....(((......)))..}))..,,,..(((((((((((((.((((.(((((,.{{((..,{{|{{,,.,{,||||.{{{{.||{.{((((.((.((((..({...(((.((((.(((((..(((((((({.......,..(((({{{(((((((((.(((((.....))).))))))).)|)},.},))},,....((((((..((((...)))).))))))....(((((((((.({((((...((({(((((((.(((((((((((((((((((....})))))}.,,,{,...||,((((.(((((((((.((((.{((...((((((((((..(((.(((.(..((..((((((((((,{((((((||,.(((((.{.((((,({.((.{....,,})})),)))}...|,)})))...}}}||}.(((((((((,....,,.(((((((((((((({((({.((((,.,(((....,|,,..))}}))})}.{|||||,||||.}))))))).)))))))))),,))))((((((,,.,|||||}..(((..((((.((((((({{(((((((((((((((......(((((((.((((....})))))).)))).)))))))))))(((((...)))}),.....(((((.(((((({....})))))).).))))....)))))))))))))))),,|||,({{(({......||{||||||,,.,,|{{|||,,|{||}|}}.,..((((((((((((....((((((.(((((((((((((((((.((((.(((((((...,......}.)))))..)).))))..))))))).))))))..{{(((((......))))).}},.((((((...))))))..))).)..)).))))..))))))))).))).{{(((((((((((((.(((((.....(((.{.((((,(...((((((((......)))))....{{(,,.(((((((...))))))),)))||.,....,(((((((((((((.((((({(((((((.((((((.((((...,({,((((({....,})))),))...)))).)))}.}))..)))))))(((((....))))).((,,(((..((({((((.,....,.).))).}.)))..))))))((((((.((((...)))).)))))).,{,||{|{||{|{{{(({...|||((((((((|(|((((((((..(({{({.((((((((((((((..((...(((.((((((.(({{{({||.((.{{{{|||||((((.({((((((((((((((((((......)))))}{{{..((((((((.((((((((......))..)))))).)))),.))))...))),,..,))))..))))))))))))).|)}}}}})})})))))))))....))..)))))))..)))))))......,(((,,{(((,,.))))))}}.{{,....,,||.)}}}}..}))))}}}})|.......))))))))}}.((,{{(({,(({.((((.,,,)}}}..,..,.(((((......)))))((((.(((((((((((({.((((....,||||{,(((((({{..{{{{,,|)|)}((((((((.((.((((.................))))))))))))))....,,}}}}.})))|((((((.(((((((..{((..,(,.((((((((((.((......}),))),..))))))).,)...))).)))))))...)))))).))))))))))))}))}....}}}.})))))),,.))))}),|((,({,.{((((....))))))))})},})))))))},,)|))).))}})))))))))),|,||,.,,.))})..))).....))))))))).)).))))))))),.||||..}}}}}),||{{{,.{(((......)))|(((........)))..,{{{......))},...................,}}||||.......})))))}).(((..{(....))..}}}........))))))....))))))))))..))..}.))).)))..)))))))))}.},)..)))).)),...........,((((((........{({......))).........)))))).......|)))))))))}..,,))))).......}))))).},,))))).{{....,,.(((((((((...}))))))))...,.||,.,(,(((((.......))))),.)))..,|,))))..}).)))))))))..((((((((.(((((..(((((((..,....{.((((.(((({,,,{({{,............)))))((((((((...(((((((((......)))))).......(((((((.,{(((((.{((.((((.{{},}|{.},}....}|,|{.}},,},)))},.((((((((..((,{...{{.{{{{,,,..))))}),..)))))))),..,..((((((....{.(((((((((({..{({.....))(((((((((.(((.(((((((((((({(((((.((.(((((((((((((.((,((..(({.(((((((((.((.......)).)))),...((((.....))))((((..((....))))))(((((((({,(.((.(((({,((((.(((({.......})))).)).))...,)))))))))))).)))).(((.(((......))).)))......})))).}))..}.).)))})....)))))))))).))..)))))........((.((((((...))))))))})))))))))))).))))))))).))).{{{{(((((.{.(({....))),}.)))))...((((((.(((((((({.(((((.(((,(((((((((((..((((((((({...})))))).)))...)))).)))....)))).)))}..)).))).),.}))))))).))))))..(({......)))))))}.))))))))))..,.......)).))))..{(,(((({{.|,...)..}))))))}..((((((((,{......).))))))))..((((((......)))))).,,...))))).)....,.))).))))..))).))))))))((((((((((.((.(((...(((.(((({...{{.{,.,..((.(((((....))).}).)).}))))))))))))))..)))))))))).....)))))..)))).)...,..}...)))))))...,.(((....))).,.....)))))...))))))))))))}))}.,.,(({.((((((....,,)}}..(({....))|,{....,||...))).)))},.))))).)))))))}...))..)).))))}))))}.)).....,....,)))},...))}))))))).)))))))))..)))))))).))))).)))))))).)))))..)))))}).((........)).{{{..{..(((((((...........)))))))..,,))}..))))))))))..)).))))}....,,.,....{(((((.(.((((........))))).)).))))...{{|,..,))).|||...{((....)}).....)))))))).)))}..,)))))))))))))))))),{.............)))))))))))),..)))))))}.}.,))))))......))))).))))..,.))))))......))},,)))})),....{{,....})))...)))).))).)))))},)))).,}.)))))))....))),})).)))),,,.....))))))...,.)).))),,.)).))),.,,))))){,|,|,,},.},}))...........))))))..).))),.....}),,)))))))).)))))},.)))))....{{((((({.{{({....|||.,,,)))}}.|||....(((....))).})}...{{{....}}}.....)))})))}.,))}..,(..((((.((({(((((((((((((((,,((...((((((((((.(({(,.({{{,(((((..((((((..(((.((((((...(((((((((((.(((((,.....{(((((((((((((((((.{.{{{...,((...(((.({....)).)))..)))....(((((((...(((.(.(((...(((((..((.((.,......(((((((((((((,...(((....}}}.....((((.....))))...{{((.{(({{.(((..........)))...,.})))}}...{{,.{{{((((.{(((.....}||....{||.....}))),,..{{{(({{.{{({.{{(|(.{((....,,....|||...,.||||{{...{{((,..((({.{{(({.{{((,.,{{....|||.....,)))...}}}.},,..{|||.|||||,(((....{{....|||.....,))),..,.|||||....((.(((({.(((..........)))...}.))))))...(((....(((....))).)))..........|||...{.((((((...,|(,,..,,((.(((({.(((..........)))...,.))))))....|))|....}).))))),)))...(((....))).......}}))...||||,..|{|}.||}}|,}}}.,,.({,....{{{...)))....)))......}))).,})))}...))))))).((((..((((..(((.{((,((((.(((....))).))))...}})}).})),..))))..))))..))))))).)}.))))).).).))))))..,.....)).)))))))...))).)))).)))))))..}.))))))))))(((((((((((((((((((({,,(((.....))){{,......||}(((((.{(((((((((((((((..((((..((((.((((((.......))))..)))).)).((......)}{{{....})}.(((((.....))))).((((((((...((((..({...)}.))))))))))))..{(.((((....)))).)}...))))..)))).))))..((((.((((((((((...))))))}..})))))))(((,.,((((..((((((({{(((((,((({(,....{{{|||,||,.....,,,,,}|||}}((((((((.{.....(((......((((((....(((((((...)))))))....))))))(((((((.....)))))))........(((((((((.((((((((((....}}..}).)))))).)}.....))))))).)))..,..}.))))))))..,,|{|,|,.(((((...)))))..,,..|}|,|}|||}}.})))})),,,)))))))...)))))))).))))))).....,.))))).|}{((((((..(((((((((((((((((.....)))))})})).)))))))).)))))))))))))))))))))...))))))))))))))))))))).)))))))))))...)))))).)))))))))..)))))}.)))))},,.)))))))))).)).,)))))))))).))))).....(((((((((((((((.((...((((((.......)))))).)).)))))))))))))))....))))))))..)))))..

Transcripts

ID Sequence Length GC content
GCAAAUGGACCAUCUGUUGGAGCUCAGGAGGCUGGGCUCCUGCCCAAGG… 8014 nt 0.6180
Summary

This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, and two C-terminal large repetitive regions, both of which contain a high percentage of glutamine and glutamic acid residues. This protein is a retinal-specific protein. Its exact length varies among individuals due to the presence of a 16aa repeat in the first C-terminal repetitive region. The 16aa repeat is encoded by the highly polymorphic 48-bp repeat, and 1-6 copies of the 16aa repeat have been identified in normal individuals. The current reference sequence shown here has a single copy of the 16aa repeat. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Mutations in this gene cause occult macular dystrophy (OMD). [provided by RefSeq, Sep 2010]

Forensic Context

No relevant information is available at the moment.