Basic Information

Symbol
ATP6V0D1
RNA class
mRNA
Alias
ATPase H+ Transporting V0 Subunit D1 VPATPD P39 ATP6DV ATP6D VATX Vma6 ATPase, H+ Transporting, Lysosomal (Vacuolar Proton Pump), Member D ATPase, H+ Transporting, Lysosomal 38kDa, V0 Subunit D1 V-ATPase 40 KDa Accessory Protein V-Type Proton ATPase Subunit D 1 Vacuolar Proton Pump Subunit D 1 32 KDa Accessory Protein V-ATPase AC39 Subunit V-ATPase Subunit D 1 ATPase, H+ Transporting, Lysosomal 38kDa, V0 Subunit D Isoform 1 H(+)-Transporting Two-Sector ATPase, Subunit D V-ATPase Subunit D1 V-ATPase, Subunit D
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_004691.5
Sequence length
1636.0 nt
GC content
0.5746

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-609.40 kcal/mol
Thermodynamic ensemble
Free energy: -642.83 kcal/mol
Frequency: 0.0000
Diversity: 486.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.((((((((.((((...)))).((((.((.((.((....)))).)).))))))))).))).((((((((((((((....)))))..(((......)))))).))))))....(((((((((((.((((((((....)))))(((((((((((((((((............((((.(((((......((((..(((((.....(((((((((((((.(((.....((((((..((((((.(....).)))((((..((((....(.(((.((((....)))).))).)..))))..))))(((((((....)))))))..)))..))))))....((((((((..((.....((.((((((.((((((.((((..((((((((((......))))).(((.((.((((.((((((.(((((((((......))))).(((((((((..((((.....)))).))))....))))).(((((((((..........((((((.(....)))))))................((((....))))....(((((.....(((((((..(((((((((.(.(((.(((((.((.(((((.(.....).)))))))............)))))))).))))))...........((((((((.((.....))))))))))..(((....)))..))))....)))))))(((((...))))).))))))))))))))..................((...(((((((((((.((.(((..(.((...)).)..)))...)).))))))))))).)).((((((((((((((((((.(((((((.(((((.(((((.............))))).)).)))...))).))))...))))))(((((.(((((((.....)).))))))))))((.((((((((((((((..((((((((((((((((((.((..((.((((.(((.....(((...)))..))).))))...))..)).)))).))))...))))))))))..))(((((((.......((((((..(((((...........)))))...))))))......)))).))).........)))))))))))).)))))..)))))))))...((((.....)))))))))))))).)))))).)))...)))))..)))).))).))).)))))).))...))..))))))))..)))))))...))))))))).....)))))))))))))))))).((((.(((.....))))))).........))))).......))))))))))))((((((((((((((((.(((.......(((((.......)))))(((((...((((((.((((.(((........((.....((.((((((.......)))))).)).....))........)))..)))).))))))..)))))((.((((....((((.((((....(((((((((((...))))...))))))))))))))))))).))))).)))))))))....)))))))....)))...)))).))))))).)))))......(((..((((..............))))..)))....
Thermodynamic Ensemble Prediction
.({{({.(((((({({{(({...}}}},{(((,((,{({((,,,,|}||,|},||}|}||||,|||,((((((((((((((....)))))..(((......)))))),,))))).,,,((((((|{{((|{,,{((((....))))|(((((((((((((((,,{{....,}}..}}}|(((({{({({((,,{{..,.|,.|}},..,}})),)}}}}},.)}}}{(((((({{(((((,{((((({...{{(({,,{.}|,|{{{(,,,}||}|{|,,.},)),),|||{{,|||}{,{{.{{(((((((.,,,||}}}}},,,.}},,,|||,,,,.})||))}}.})))),}}}}.,.|..............))))))))))))}.....,,|.((((((((.((((.(((.(((((...)))))(((((((((((((({..{(((..((((.....)))).))))))}}}.))).)))))))))))))).....((((((.{....})))))).....(((((..((((((.(((...(((......)))..})}.))))))..)))))...)))))))).,{((.((.(((((.(.....).)))))))))}..{{{{...,.{(({{{{..,{|||||,,||||..{({{((((.{(,....|||||||}}}..(((....)))..{{{{..(((((((({(((((..((((((((({((((...(({{{.((((({..........((...(((((((((((.((.(((..(.((...)).)..)))...)).)))))))))))..},(((((((((((((((((({(((((((.{(,,,.,,,{{....{{{{,....,,)))}),.}}},..))),}))).}.))))))(((((.(((((((.....)),})))))))))((.((((((((((((((..((((((((((((((((((.((..((.({{{,{((.....{{{...}})..)}},})}},}.))..)).)))),,)))...))))))))))..))(((((((.......((((((..(((((...,....,..)))))...))))))......))))},)).........)))))))))))).)))))..)))))))))...((((.....)})))})})})}}}}}},},}|||},,.},}}}}}}).},)))}..)))))))))..)))))....(((......)))..))))))))).,)})){{{||...,)))))}})}|||,|{,,,|||.....|}}))))}}},...}})))))....}))))))))))))))|{{,({{{{{,{|{{(|{,{......,}||||.{{{..{((((({{{({((((({(((,{{{{,|||..},,||.{,.....{(.((((((.......)))))).)).....,}}}...}.,)}),,)))).,))))}}}|||||,,,,,,,.}}}}}}|}||({(((((((((((((((...))))...)))))))))))}))|,{,|,..,,},|}|}}}}||{{{,|||||||..{,|||....})))}}))))),})))}...}}}}},..||||,,...,,,,})}},))}}..}))}}..

Transcripts

ID Sequence Length GC content
AGCUGACCUGGGGAGUCGCGAUUCGUGCCGGCCGGUCCUGGUUCUCCGG… 1636 nt 0.5746
Summary

This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is known as the D subunit and is found ubiquitously. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly upregulated the ATP6V0D1 in oligodendrocytes, as part of a broader disruption of lysosomal function within this glial cell type [Oladapo et al. DOI:10.3390/Ijms26020649].