| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGACCUGGGGAGUCGCGAUUCGUGCCGGCCGGUCCUGGUUCUCCGG… | 1636 nt | 0.5746 |
This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is known as the D subunit and is found ubiquitously. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly upregulated the ATP6V0D1 in oligodendrocytes, as part of a broader disruption of lysosomal function within this glial cell type [Oladapo et al. DOI:10.3390/Ijms26020649].