| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGCUACUCAGAUAAGAGGCUCCAAGAGGACAUUUUUGGAUGUGAAAAA… | 2020 nt | 0.4589 |
Enables damaged DNA binding activity and single-stranded DNA binding activity. Involved in DNA metabolic process. Part of DNA replication factor A complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans using post-mortem tissue RNA sequencing demonstrated that the RPA3 gene, involved in DNA repair and telomere maintenance, was downregulated as part of inhibited base excision repair and telomere maintenance pathways specifically in the lungs of sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].