Basic Information

Symbol
RPL10A
RNA class
mRNA
Alias
Ribosomal Protein L10a Csa-19 NEDD6 L10A UL1 Neural Precursor Cell Expressed Developmentally Down-Regulated Protein 6 Large Ribosomal Subunit Protein UL1 60S Ribosomal Protein L10a NEDD-6 CSA-19 CSA19
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_007104.5
Sequence length
718.0 nt
GC content
0.5084

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-222.80 kcal/mol
Thermodynamic ensemble
Free energy: -234.91 kcal/mol
Frequency: 0.0000
Diversity: 226.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((...(((.......)))(((((((.((..((.....))..)).)))))))...((((.....))).)(((((((....)))))))((((((..((((....).)))..))))))))))))((((((((((.....))))))...(((((.(((((((.(((((........))))).)))..((....))(((..(((((((..(((((.....(((..((((((((((((((((((((((((((.((......)))))...))..)))...)))))))...))))(((..((.(((((........................(((((((((..((((((((((((((...))).)))))))))..))..))).))))))....(((((...))))).))))))).)))........((((((.(((....))).)))))).)))))))..))).....)))))....))))))))))(((.....))).)))))))))((((((....(((((..((((...((...((((..(.(((.(((....)))...))).)..))))...))...)))).)))))..((((((..(((((((((....))).))))))....))))))..((((((((((((.......))).)).))..))))).((....))((((......)))).))))))............))))....
Thermodynamic Ensemble Prediction
.{((((,...(((.......})}{{{{||{.((..((.,,,,}}..||,}}}}|}},{.,({{,....))).,|((((((....)))))}|((((((..((((....),}))..)))))))}}}||{(((((((({{,{.{{{{{{{{,.,..,..{{,,{((,(((((........))))).))),,||,}}}))||,..(((((((..{{(((,,,.,(({,,((((((((((((((((((((((({((.((......,||},...)),.))}...)))))))...))))|{{..((.(((((......,,.....,.........,(((((((((..((((((((((((({...})).)))))))))..}},,)}),)))))}.,..(((((...))))).))))))).}),........((((((.(((....))).)))))),)))))))..))}.,,.,))})),...))))))),||{{{,,.,.}}}..,|||||||,,..,,....,{{{({{(((,..,((,..{||{{{(.((({{.....}.)))).))),..,)))),}.}}...))})}))))),}||||||.,|||{{{||{|...})),))})},...{|||}}|..{{{||{{(((((,..,,..}}|.}|.}}.,|||,,..,}}}}}.||{{......)))).},,}}},....,,}},..,,}}....

Transcripts

ID Sequence Length GC content
AGUCUCUUUUCCGGUUAGCGCGGCGUGAGAAGCCAUGAGCAGCAAAGUC… 718 nt 0.5084
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L1P family of ribosomal proteins. It is located in the cytoplasm. The expression of this gene is downregulated in the thymus by cyclosporin-A (CsA), an immunosuppressive drug. Studies in mice have shown that the expression of the ribosomal protein L10a gene is downregulated in neural precursor cells during development. This gene previously was referred to as NEDD6 (neural precursor cell expressed, developmentally downregulated 6), but it has been renamed RPL10A (ribosomal protein 10a). As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans analyzing blood samples from burn patients identified the RPL10A as a Temporal Expression Profile Gene exhibiting a significantly decreasing expression trend from 0 to 7 days after severe burn injury [Wu et al. DOI:10.1016/j.burns.2018.08.022]. This temporal expression pattern was validated in an independent dataset, where its aberrant expression in burn samples was consistent.