| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCCUGCUCUCCAUCAUGGCGCAGGAUCAAGGUGAAAAGGAGAACC… | 1017 nt | 0.4818 | |
| AAGGCCCUCGGCCGGAAGCUCCGCUUUCUCUUCCUGCUCUCCAUCAUGG… | 641 nt | 0.4899 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
A study in humans demonstrated that the RPL11 was upregulated in subcutaneous adipose tissue during short-term weight loss [Bollepalli et al. DOI:10.1038/ijo.2017.245]. A study in rats demonstrated that the RPL11 was differentially expressed in hypothalamic tissue during hypothermia, with 23 tags in control versus 8 tags in hypothermic samples, indicating its potential as an RNA marker for hypothermic diagnosis [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].