| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCCGCUCGGCUGUUUUCCUGCGCAGGAGCCGCAGGGCCGUAGGCAG… | 2187 nt | 0.5473 | |
| CCAGAGUGCAUUGCGGGGCCGCUUCCUUUCCGCUCGGCUGUUUUCCUGC… | 4358 nt | 0.5597 | |
| AGGUGAGGGAGACUGGGUCCUGGCCUUUGGGCAUCAUCCAGCGCCAUCG… | 4672 nt | 0.5691 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L13E family of ribosomal proteins. It is located in the cytoplasm. This gene is expressed at significantly higher levels in benign breast lesions than in breast carcinomas. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2011]
A study in humans demonstrated that the RPL13 was among the most highly expressed housekeeping genes with a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In contused rat skeletal muscle, the RPL13 was validated as the most stably expressed reference gene across post-injury time points using NormFinder, geNorm, and BestKeeper analyses, and its use in combination with RPL32 was identified as the optimal internal standard for accurate normalization of RT-qPCR data to estimate wound age [Sun et al. DOI:10.1007/s00414-011-0604-3]. In a forensic study using contused skeletal muscle from Sprague-Dawley rats, the RPL13 was validated as a stably expressed reference gene for RT-qPCR normalization in wound age estimation models [Li et al. DOI:10.1007/s00414-023-03095-x].