Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUCCAAGCGGCUGCCGAAGAUGGCGGAGGUGCAGGUCCUGGUGCUU… | 1051 nt | 0.5414 | |
| CUUUUCCAAGCGGCUGCCGAAGAUGGCGGAGGUGCAGGUCCUGGUGCUU… | 1127 nt | 0.5386 |
Summary
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Forensic Context
A study in humans demonstrated that the RPL13A was identified as a highly expressed housekeeping gene with a low coefficient of variation across individuals, showing it was nearly insensitive to random environmental variations between monozygotic twins but more susceptible to genetic differences between unrelated individuals [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In forensic autopsy cases, the RPL13A was validated as the most stable reference gene in human lung tissue using the geNorm module, enabling accurate normalization for RT-qPCR analysis of molecular pathology in fatal methamphetamine intoxication [Du et al. DOI:10.1111/1556-4029.13199].