| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCUCGCCUAACGCCGCCAACAUGGUGAGUCUUACUGUUGCGGGCUCC… | 7136 nt | 0.4446 | |
| CUUCUCGCCUAACGCCGCCAACAUGGUGUUCAGGCGCUUCGUGGAGGUU… | 7025 nt | 0.4409 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in humans analyzing peripheral blood transcriptomes from burn patients identified the RPL14 as a key lactylation-related molecule with high diagnostic potential, demonstrating an AUC of 0.934 for distinguishing burn patients from controls [Li et al. DOI:10.3389/fmed.2025.1554791]. A separate time-series analysis in humans revealed that the RPL14 exhibits a significantly decreasing expression trend from 0 to 7 days post-burn, a temporal pattern validated in an independent dataset [Wu et al. DOI:10.1016/j.burns.2018.08.022].