Basic Information

Symbol
RPL14
RNA class
mRNA
Alias
Ribosomal Protein L14 60S Ribosomal Protein L14 CTG-B33 HRL14 RL14 EL14 L14 Large Ribosomal Subunit Protein EL14 CAG-ISL 7 CAG-ISL-7
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001034996.3
Sequence length
7136.0 nt
GC content
0.4446

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2537.24 kcal/mol
Thermodynamic ensemble
Free energy: -2664.89 kcal/mol
Frequency: 0.0000
Diversity: 1785.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((...............))))))...((((((.(((((...(((((((((((((((.(((((.((((((((((.....((((((..(((.((.(((....))).)))))....))))))(((((((.((.....)).)))))))))))))))))))...((((((.((...(((...((........)))))..)).))))))..((((.(((.......)))...)))))))..)))))))))).)))))........((((((((((((((((((((....)).)))))..))...)))...)).))))))....)))))))))))..................((((((((((.(....).))).....((((((.((((((((....(((..(((((((.((((((..(((.((((((((((((((((...(((((....(((((.....))))))))))...)))..((((((.(((((((.......(((....))).....((((((((((..((......))..)).))))))))........((((.(.((((((...))))))).))))((((((.(((.(((((..(((.....)))..)))))............((.(.((((......))))).))......(((....)))......(((...))))))..))))))..(((((((....((((....)))).....(((((((((((((...((......(((((((((.(((....)))..((((..((((((....(((((((.(((....))))))))))...)))).))..))))......)))))))))......))...))).)))))))))).))).))))...........((((((............)))))).))))))).)))))))))))))))))))...((.((((.((.((((.....)))).)))))).))((((((.......(((.(.(((((.((((((.......(((....)))......((((.((((....)))))))).)))))))))))).)))))))))((((((((((...(((((((.(((((((((((((((((((((((((((((((.((((((.((((((........(((.(((.((((.((((.(((((((((((((((((((((.((((((.(((((((((((((((.(((((((((....((((((((((((..(((..((((((.(((.(((((....))))).(((((.....)))))((((....))))..((((((((....)))))))).....(((..(((((((((.((...((........))...)))))).))))).)))....((((((((..(((..((((..((((((.((((((((((((((((((((..(((((((((...)))))))....))....))))))))))))))))).(((((((((((.((((((((((((.((.((((((((((((((((((((.((((((.(((.((((((((((((((((((.((((((((((((((((((((((((((((((((((((((((((((.((((((((..((((((((.(((..((((((.......((.(((((...)))))))...))))))..)))))))........((((.(((.(((((((.((((.(((((....)).))))))))))))))))))).))((((((((((((.((((............(((((((...)))))))...........))))..)))))))))))).....((((((((((.(((.....)))...)))))).)))).((((((.((((((((....))))))))..))))))...))))(((.((((((.(((((.(((((((((((((((((((((((((((((((((((((((((((((((.((((((((((.((((((((((((((((((..(.((.((((((((((((((.((((((((.((((((((((((((((((.(((((((((((.(((((((.(((((..........(((......))).((((.........))))(((((((((..................)))).))))).....................................(((((((((.....))))))))).((((...(((((((....((......((((((((((((((((..............)))))))).)))).....)))).......)).....))))))).))))..(((((((((....(((((.(((....)))))))).(((((..............((((((((((((((((((......)))))))))((((((((((((((.....(((((((((((((....((((..........))))....)))))))...))).)))....((((((....))).)))....))))))).....)))))))((((((((((((((((((.((.((((((((((((((.(((((..(((((...((((((((.........)).))))))....((((((((.(((((((..(((((((((((((.(((((((((((((.(.((((..(((.(((((..(((((((((.((((((((...))))))))..(((((((.((((.(((.....)))))))...)))))))..(((((((.(((......(((((.(((.(((((......))))).....(((....)))...((((.(((..(((((.(((..((.....))..))))))))..))).))))..)))..)))))))))))))))..................(((((((((....))))))))))))))))))..)))...................)).))))))).).))))).)))))))).......((((..........))))..((((((.................)))))).((((((.....((((....(((............)))...)))).......(((.((((((((((.....(((((....(((((((((...((((((......))))))..)))))))))....))))).(((((((((...(((((((((((((.((.((((....)))))))))))))...))))))....((((....(.((.((((((.(((........))).))...)))).)).).....))))....)))))))))..)))))))))))))..((((((((((((................(((((..(((((((..(......).))).))))..)))))...((((((((((..((((((((((....((((..(((((....((...(((((((((((((.(((.....))).))))))..)))))))))....)))))...))))......))))))))))......(((((((.((....))))))))).........))))))))))....(((((..(((.......)))..)))))....))))))))))))(((..((((((((.....................))))).)))..))).(((((((..(((((.((((....))).).))))).))).)))))))))).)))))))))))))..(((((..............))))).....))))).)).))))))))...)))))..)))))((((..(((...........(((((((((..(((.((.............)).)))..))))))))).......))).))))))))...)))))))))).)).......((.(.((((.((((((.(((....((((((.....))))))......(((.....)))..((((((.........)))))).....((((.......)))).((((......))))....)))..)))))).)))).).))))))))))))))))))))(((......))).((((((((.((((((...............((((((...((((((.((((((......)).)))).))..)))).)))))).(((((((....(......)....))))))).....)))))).))))))))....((((((...))))))......(((((((((.....(((((((...(((((...)))))....)))...))))...)))))))))..)))))))))..(((((......))))).(((((...((((...........))))..)))))....((((.....(((((.((((((....)))))).))))).......))))((((((...)))))).....)))))..................))))))))).....))))))))))))))))))))))).)))))))))))))))))).)))))))).)))))))))))))).)).)..)))))))))))))))))).)))))))))).))))))))))))))))))))))))))))))))))))))))))))))).))))).)))))).))))))))))).)))))))))))))))))))))))))))))))))))))))))))).))))))))))).......))))))).))).)))))).)))))))))))))))))))).)).))))))))))))))))))))))).........((((...(((((....)))))..))))))))))))).))))....)))..)))))))))))..)))))).)))..............((((........((((....)))).....))))((((.........)))).(((((((((.........))))).))))......)))))..)))))))..))))))))).))))))))))))))).)))))).))))))))))))))))))))).)))).)))).))).))))))))).)))))).))))))))))))))))))))))))))))))))))))))............((((((........))))))..(((((((....(((...((((((((((((....((((((...((((....(((((...)))))......))))(((((...(((.((((((((((....(.(((((.(((...............))).))))).)..)))))).))))))).)))))....((((((((..............))))))))....)))))))))))))))).))....)))..))))))).(((((((.(.......(((...((((((((((.((..(((((((.(((..((((......))))..)).).))).............((((.(((..(....)..))).))))...(((((((..((((((..(((((..((((((((.((.............)).))))))))..)))))......))))))..)))))))..(((((.(((((..............))))).)))))((((((.((((.....((((.(((((............(((((.((((((((......((..(((((((........(((.((((((....(((((((((((......)))))))))))..)))))).)))......)))))))..))...)))))))).)))))(((((((((.....((((((..........))))))..)))))))))......))))))))))))).))))))))))..)).))))))))))....))).........(((...(((((((((....))))....(((((((((.(...........(((((....))))).((((..(((.(((((..((((((.((((.(((((...)))))..))))((((.....)))).(((.((((.....(((((.((((((((((((((...)))).........(((........))))))))..((((...((((.....)))).....))))...(((((((...((((......))))...)))))))((((((((((((((((((((((((((.((((((...))))))(((((...)))))......(((((.((......)).))))).(((((((((((((.....(((((((((.....(((((.................(((((................................)))))....(((((((..((((....))))....)))))))..((((...........))))..))))).....)))))))))(((((..........)))))((((..(((((...((((((((.((((((((((((((.(((....))).))))))))))..))))))))...))))...))))).))))....((((......))))..)))))).))).)))).....((((((..((((((((((....(((((.......)))))(((((...))))))))))))))).))))))...))))))))))))))))))))))))))))))).)))))))))...)))((((((((.....)).))))))......(((....)))...))))))))))))))..)))).........((((.((.(((((((((.(((((((((........))))))))).)))))))))..)).))))..).)))))))))...))))))))(((((((.....(((((.......)))))))))))).).)))))))((((((((.(((......)))))))))))......(((((......(((((...((.....))..)))))......)))))..................))))).))))).(((((((....)))))))..)))..)))))).)))))))...))).......)))))..))).))))))........(((((.(((.....((.(((..(((((...((((...))))...)))))..))).)).....))))))))............................)))))))..
Thermodynamic Ensemble Prediction
{{{({.({.....|,,||,....{||||.{,..{(((({{(((((,..(((((((((((((((.(((((.((((((((((.....((((((..(((.((.(((....))).)))))....))))))(((((((.((,...,)).))))))))))))))))))},,|{{(({{.,,|||{{|.,,(({{,.....}}}},..,,.))))})||,{{,.||{,......}})...,,,,)))..)))))))))).)))))........((((((((((((((((((((....)).)))))..))...)))...)).)))))),},.,)))))))))),.}}}})}}}).......(((((((,((,{.,{{|{,||{{{{.((((((.{{((((((....(((..(((((((.(((((((..(((((((.,(((((((,..(((((((({,...})).))))))},{(((((.(..(((..((((((((((((((.......{{,....,||.,,,.((((((((({..(({....}}}..)}}}})))))}..............((((((((((((||.,(({({{({,((,{{.{{,{{,{,.||,|}...)))..))))}.........,,,(({{.{{({.....,||}}|{((({,{.{((({.{{{{|,.....{{{.,.||||.,..||||},}}|||{({{....{(((,...||||.....(((((((((((((...((....,.(((((((((.{{{.,..}}}..{({{..{({{{{.,,.{,{{{{(.{{{...,|||)))))))},,)}}},}}..}}}}......)))))))))......)).,.))).)))))))))).|||||},|{{{({(,{,,{{{{...........,,...,||||||}}}}}||{{((((((((((({{{{,(((({...)))))(((({((((((((((..((((((((((((.(({.....)))))))))),,)})),.......|(({,...||,.......,|}.,.})}},)))))))))).)))))..(((((((........)))))))......,{{(((.((((((((((((((((((((((((((({(((.((((((.((((((........(((((((.((((.((((.(((((((((((((((((((((.((((((.(((((((((((((((.(((((((((....((((((((((((..{{{..((((((.(((.{((({....}))}}.(((((.....))))}((((....))))..((((((((....)))))))).....{{{..(((((((((.((,{.((........})...}}))))}})))).}}}....((((((((..(((,.((((..(((({{{((((((((((((((((((((,.({(((((((...)))))))....))....))))))))))))))))}..,{(((((((,(((((((((((((.((.((((((((((((((((((((.((((((.(((.((((((((((((((((((.((((((((((((((((((((((((((((((((((((((((((((.((((((({..{,((((((,(((..((((((.......{{.(((((...))}))}}...}|||||{{|||||||......,.((((.(((.(((((((.((((,(({((....)).))))))))))))))))))}.)}(((((((((((({((((.....,{,....(((((((...)))))}}.....,,,...))))},}))))))))))).,...((((((((((.(((.....)))...)))))).)))),((((((.((((((((....))))))))..)))))}..,||||{{{.{{|||{.(((((.{((((((((((((((((((((((((((((((((((((((((((((((.((((((((((.(((((((((((((((((({.(.((.((((((((((((((.((((((((.((((((((((((((((((.(((((((((((.(((((((((((((..........(((......))).((((.........)))),{((((({{.,,((({{,.{{{.....||||.||{{{(({{,.{(.{,.{{{{{{,.,............{{({(((({{((({{{..,))))))},.((((...(((((((....,,,,..,.{{{{{(({((((((((..........,...)))))))).))}).....))}}.,.....}}.....))))))).)))){{(,(((((((((({{((((,{{(....}|}}}}}}.(((((,......{{{{,{,,,,{,{{{((((((((((......)))))))))},((((({{,,,{||||,{,((((((((((({{{{{((((..........)))}...,|||||}|...,,|{|||{{..,,,.,,......,.,||,...,})))},......)))))}|,||{{{{{{{{{{,.,,,|}}}.,|,||||||,((((((((.,(,,(({{{,{{{{{({{((((((({((({.(((,{{{{((,,(((({{,({(((..(((((((({((((.(((((((((((((.(,((((..,{{,(({{,..{{(((((((.((((((((...))))))))..(((((((.((((.(((.....)))))))...))))))),.{{{{((((((({,,,{{(((((,(,,.(((((......)))))...}}|||}.||||}...((((.(((..(((((.(((..({.....))..))))))))..))).))))..|||{|||}}}}}})))))))..........,{,,..,.(((((((({....}))))))))})}))))))}.............,}|,....,,)),))))))),}.))))).)))))))).,{,...{{{{,.........}}}|||{{((((,............,,,,))))),.||||{|,,,,,||{(....{((........,...}}}...))}}...,..,|,,}||{(((((((...,{((((,,...(((((((((...((((((......))))))..)))))))))...}))))}.{((((((((,,,{((((((((((((.((.((((....)))))))))))))}..,)))))|,..((((....,.((.{{((((.({{........))),)}...}})).}}....,..)}}),,,.}))))))))..))))))))}}|||..((((((((((((................(((((.,(((((((..{......}.))).))))..)))))...((((((((((..((((((((((...,((({..(((((....((,{{({{((({((((((.(((.....))).)))))).,))))))}))....)))))...}}))......)))))))))),{{...(((((((.((....)))))))))},,......)))))))))).,,,{((({.,{{{.....,.})}..))))),,,.)))))))))))).|}},||||||||||....,,,,{,......}),)},))})),}})))},|||{,,,,,||||}}}}},.......,.,,,)),)))})))))))))).,))))))))|||,..,,,||..}}}}.}},},}})))),},..})))),.)).))))))))}..}}}||,,}}))........}}}}}}}}.....,|{{{||||,,|||,||..,....,,,.,,)),)))..)}}})))},..,...})))}}},.}),})))))})}|,|||||||{{{.,{{||||||,..,{((((......}}}||(((,,,..,}},(((({{...(({{{{,,||,.((((((.........)))))).,,|.((((.......,},}.,{|||,||,,{{{(((((((,.....|||||}.,..{{{|.{{(((..((((((,{((((((((...)))))))}...(((((.({...}).))))}.....)))))).))))).)))),....))))))),,,))))))...(({{{{((.(((((((....,......)....)))))))))))))).||{{,,.{{{,,{{..((((((.,.,,.,},}}))}},,|}|}||,}}}}.,|{{{{({{,(((({,.,|||||||,.|||,.,}}|||.,|||||})})|..},,},}},,,)))|}}}}}}}}..(((((......))))).}))}},....}})))}}}))},.,|{{|,....(((((.((((({....}))))).))))).......}}}}((((((...)))))).....}}}.}}},,,......,,,,}..|||,.,))).....))))))))))))))))))))))).)))))))))))))))))).)))))))).)))))))))))))).)).).})))))))))))))))))).)))))))))).))))))))))))))))))))))))))))))))))))))))))))))).))))).)))))).))}}))))))).)))))))))))))))))))))))))))))))))))))))))))).))))))))))).......))))))).))).)))))).)))))))))))))))))))).)).))))))))))))))))))))}||({{{,.,,{{{,,....|||}.....})})},})))))))))))).)))).}..)))..)))))))))))..)))))).}}}.......,,,,...,,(({{{{,,,...,{{{,.||..,....})))||{{....}}}}})))).(((((((((.........))))).))))......)))))..)))))))..))))))))).))))))))))))))).)))))).))))))))))))))))))))).)))).))))}))),))})))))).)))))).)))}))))))))))))))))))))))))))))))))))))))))))))))|,||||||,.....||||||,,.{(((({....|||.,.{(((((((((((,...{(((({...|{{{..,,{{{((,.,})},,.,....,},.(((((...(((.((((((((((....(.(((((.(((..,{.......,,..))).))))).)..)))))).))))))).)))))....((((((((.,,......,,...))))))))....})))}))))))))))),.}....}}}..)))))))))))},.}}}.......(((((((.((|{{|...,}}}.)).))))))).|||,....}},|.{{{{{{........)))}}},,,,,((({,(({..{....)..))).)))),,.,},.,},))}})))))))}.........))).))))))).)))).)))..)))))))))))))))..))).)))).)))).,{,,,..,,{{,,.|,||,.........{{{{{{{{{{,{{||.((((((.(((({{,,,,(((.,,,,......,......{((((.((((((((......((..(((((((,,,,....|||,{(((((,,,.(((((((((((......)))))))))))..))}))).}},......)))))))..))...)))))))).))))}(((((((((.{,..({((({......}},.))}))),.)))))))))......))))))))))))).)))))){(((((((((((..,{......}}.))))),......,,{,(({{{((((....}}}|....(((((((((,{....,,....,(((((....)))))}((((..((,{(((((..((((((.,({(,(((((...)))))..))||((((.....))))}|,(.((((.....(((((.((((((((({((((...)))).........(((........))))))))..((((...((((.....)))).....))))...(((((((...((((......))))...)))))))((((((((((((((((((((((((((.((((((...)))))){((((...))))}..,...,{{||,{{,,,...}),)}|||.(((((((((((({.....(((((((((.....(((((................,{{{{{....,,,{,....,.,,,,........{{{.{{{,,,.}}},|||||,..{{{{..,.))))....,,)))))}.{(((...........))))..)))))...,,)))))))))||{{{..........)))}}((((..{{(((...((((((((.((((((((((((((.(((....))).))))))))))..))))))))...))))...))))}.,}})|||,((((......)))),,)))))).))).)))).}}}.((((((..((((((((((,..{(((({.......))))|(((((...))))))))))))))).))))))...))))))))))))))))))))))))))))))).)))))))}}...},,((((((((.....)).))))))......(((....)))...))))))))))))))..)))).........((((.((.(((((((((.(((((((((........))))))))).))))))))}..)).))))..,.))))))))},,,||||||||||,{,,({,.,.(((((.......))))),}))|((((((((........))).)))))|{{,......}))},....,..(((((......(((((.,.((.....)).,)))))......)))))...,))))))...{{{{{{{,,....))))}}|||,.....)))))))}))}}))),}))).)))))))...))).......))))),.,)}.)))))).,,{(((..((({..,|,,.,,||.,{,..{{{{{...{(({...))))...}}}}}}})))}.)}}}}.}},,}}}.......,{{,,{{....,,}}.))}...)))))))..

Transcripts

ID Sequence Length GC content
CUUCUCGCCUAACGCCGCCAACAUGGUGAGUCUUACUGUUGCGGGCUCC… 7136 nt 0.4446
CUUCUCGCCUAACGCCGCCAACAUGGUGUUCAGGCGCUUCGUGGAGGUU… 7025 nt 0.4409
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14E family of ribosomal proteins. It contains a basic region-leucine zipper (bZIP)-like domain. The protein is located in the cytoplasm. This gene contains a trinucleotide (GCT) repeat tract whose length is highly polymorphic; these triplet repeats result in a stretch of alanine residues in the encoded protein. Transcript variants utilizing alternative polyA signals and alternative 5'-terminal exons exist but all encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans analyzing peripheral blood transcriptomes from burn patients identified the RPL14 as a key lactylation-related molecule with high diagnostic potential, demonstrating an AUC of 0.934 for distinguishing burn patients from controls [Li et al. DOI:10.3389/fmed.2025.1554791]. A separate time-series analysis in humans revealed that the RPL14 exhibits a significantly decreasing expression trend from 0 to 7 days post-burn, a temporal pattern validated in an independent dataset [Wu et al. DOI:10.1016/j.burns.2018.08.022].