Basic Information

Symbol
ATP6V1A
RNA class
mRNA
Alias
ATPase H+ Transporting V1 Subunit A V-ATPase Subunit A ATP6V1A1 ATP6A1 Vma1 VA68 VPP2 ATPase, H+ Transporting, Lysosomal 70kDa, V1 Subunit A V-Type Proton ATPase (V-ATPase) Catalytic Subunit A V-Type Proton ATPase Catalytic Subunit A Vacuolar Proton Pump Subunit Alpha ATPase, H+ Transporting, Lysosomal (Vacuolar Proton Pump), Alpha Polypeptide, 70kD, Isoform 1 H+-Transporting ATPase Chain A, Vacuolar (VA68 Type) ATPase, H+ Transporting, Lysosomal, Subunit A1 H(+)-Transporting Two-Sector ATPase, Subunit A Vacuolar Proton Pump Alpha Subunit 1 Vacuolar ATPase Isoform VA68 V-ATPase 69 KDa Subunit 1 Vacuolar-Type H(+)-ATPase V-ATPase 69 KDa Subunit V-ATPase A Subunit 1 EC 3.6.3.14 EC 7.1.2.2 EC 3.6.3 ARCL2D IECEE3 DEE93 HO68
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001690.4
Sequence length
4575.0 nt
GC content
0.4046

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1300.90 kcal/mol
Thermodynamic ensemble
Free energy: -1388.53 kcal/mol
Frequency: 0.0000
Diversity: 920.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((....(((...(.(((....))).).))))))))))).((((((((......((((.((......))))))............((((....)))).......(((((((..((((((.((((((((((.((.(((((((........(((((((((..((((...)))).((((.((((.((((((.......)))))))))).))))....(((((((((((((((.((((((((((((((...((((..(((.((((((((((((((((....(((((((..(((...((..((((((.((((((((((............((((..((..((.(((((.((((((((((((((.((((...((((...))))...((.((((((((...(((....))))))))))).))))))))))..)))).)))))).....))))).))..))))))...))).))))))).))))))...))..))))))))))......((((....))))))))))....((((((((((...((....))...))))))))))........................)))))))))))))))))...(((.((.((((...)))))).)))....((((((...............(((((((((((((((....((((((.(((((.((((((.((((.....(((((((..(((((((....(((......))).(((((.((((((((((((((.((((........)))).)))).)))..(((((((((((.(((((((((......(((((((((........)).)))))))((((...)))).((((.((((.(((....))).))))...))))..(((((((.((..((((....))))..)))))))))..).))))))))..(((((((..(((.(((((....)))))((((((.((((.....(((((((((.((((.((.(((((((.....((((((((((((((((..(((((.((((((((...((.(((((.(((((((((((((((.........((((((((.((((((((((((.(..(((((((((((....))))))))......)))..))))))..((((((..((((....))))))))))........((.(((((.....)))))))....)))))))))).)))))((......)).(((((((((..(((((((...)))))))))))).)))).....(((((((((..((((((.((...(((((((.(((...(((((((.(((......((((....))))......))).)))...)))).))).)))))))....)).))))))..))))))))).(((........)))(((.......)))..(((((...(((((..(((.(((((((.(((.(((......)))))).))..)))))...))))))))...((((....))))((((((......))))))(((((..(.((.(((((((((..........))).)))))).)).)..)))))..)))))))))))))))))))).))))).......))...))))))))(((.(((((.((((((..(((.(((...........))).)).)..))).))).))))).)))...........(((((((....)))))))...(((((.......)))))...)))))..)))))))))).....((((......))))((((..((..(((((((..(((((...(((.(((((((((((..............(((((.(((.(((...))).)))......))))).((.(((((.((((.((((..((..(((.........((((.(((.(.(((.(((....))).)))).))).)))).)))..)).))))(((((((....))))))).)))).))))).))..))))))))))).))).....(((.....)))(((((((....((((...........)))).))))))).))))).)))))))..))..))))(((((........((((...((((.......((((((((((((((((((....((((((((((((((.((..((((((((((......))))))........(((((((....(((((((....))).)))))))))))(((((....)))))....((((((((((...........)))))................)))))(((((((...........))))))).....)))).)).)))))...)))).)))))....)))))).........(((((......)))))....(((.(((((((....).)))))).)))..(((((((......)))))))((((((.....))))))...(((((........)))))....((((((.............))))))...)))))))))))))))).))))..))))).....))))))......................................((((((.....))))))((((..((((((((((.((((....(((.........))))))).)))))).........)))).)))))))))))))))))))))))))).))))..)))))).....((((((......)))))))))...))))))).((((((((.((((..((((.(((((.....((((.((..(((.....))))).))))...)))))...)))).(((.(((((((((......)))))....(((((((......))))))))))))))((((((...((((.......(((((...(((..((((......................((((.....)))).........(((....)))........))))..))))))))....)))).))))))..))))))))))))........))))))))))).......(((((........))))).)))))))...)))))....(((((.((.(((..........((.((((((((((((((((.......))))))((((((((((....)))))))))).......))...))))))))))...........))).))...)))))............)))))))))))))).....))))..((((((((((((..((((.(((((((...(((((((.(((((.(((.....))).))))))))))))......(((........)))..(((.((...)).)))(((((((.((((((((((((((((.........))))).))))))...))))).))))))).....)))..))))))))..)))))))).))))........((((((..((((...))))..)))))).((((((((((....))).))))))).(((((...((((.......))))...)))))))))))...))))).))))))((((....))))((.((((((...)))))))))))))))))).)))))..)))))).....))))))))))))))..))))(((((((((..((((((((....)))))))).((((((.((((.((........)).)))).))))))......(((..(((((((............))))))).)))......((((((((((....))))))))))((........))(((...((((...(((((((...(((.(((....((((((.((((.(((((......((((.((((.(((....))))))).))))..))))).)))).))))))))).)))...)))))))..))))..))).(((((.((.......)))))))((((((......))))))..)))))))))..........((((....)))))))))))))))..)))))))))...(((((((......((((((.................)))))).......)))))))((((((....((((.(((.((.....)).))).))))....))))))))))))).)))))))))))).)))))).)))))))......(((.((((((((.......))))))))))).((((..((.((((((..(((.((((...(((......)))....)))).)))....))))))))..))))(((.(((((......(((((..((((((((((((((....)))))((((.......))))...((((((...))))))((((((((.(..........).))))))))((((((.....))).)))..............)))))))))....)))))))))).)))....)))))))).....(((((...(((((............(((((.(((((.((....)).)))))((((....))))....(((.((.((((...)))).)).)))..............))))).............)))))...)))))..
Thermodynamic Ensemble Prediction
,,,((((((({,....||,}.(,(((,,..|||,|{|||}}}}|||}.((({(((,..,}}.|||{.|{,.,,,,)}))))............((((....)))).......(((((((..((((((.(((((((((((((.((((((({,....,.(((((((((..((((...)))).((((.{{{,{((((((.......)))))))}}}.))))....(((((((((((((((,((((((((((((((...((((..(((.((((((((((({{{{{....((((((,.{(((...({,.((((((.((((((((((,....,{{,,.,{{{(,{{,..{{.{{{{{.(((((((((((({.(((((...{(((...)))}...{(.{(((((((...(((....))))))))))).)})))))}}),,)))).)))))).....))})),))..,}}})}.,.)))}})))))).))))))...)}..))))))))))......{(((....))))||}|||,...((((((((((...({....})...))))))))))........................))))))))))))))))).{{((({,,.{(((...}}}}}}.}||,...,{|||,........}}}}}}.(((((((((((((((....{((((({(((((,((((((,,(((....,(((({(({{((({{{{,,,.(((......))).{{{{{.{{{{,,{(((((((.((((,......,)))).))))}|}}..(((((((((((.(((((((({.....,(((((((,{........},.)))))))|(((...)))}.((((.((((.(((....))).))))...))))..((((((,{((..((((....))))..))))))))),,).))))))))...{(((,,.{({(((((((....))))))|,|||},|||,....(((((((((.(((,{((.(((((((..,{.((((((((((((((((..(((((.((((((((...{,.(((({.(((((((((((((((.,.......((((({((.(((((((({{((.{..{{{{({((({(,,,,||||}}},.,,}}})))}}}}}}}}..((({({..((((....))))}}||||....,,},||.|{{{{,{{,,|},}}||....||||}}||}}.})))}((......)),{((((((((..(((((((...)))))))))))).|||}{{{{{({(((((((..((((((.((...(((((((.(((...(((((((.(((......((((....))))......))).)))...)))).))).)))))))....)).))))))..))))}||||,{{(........)))|||}......}))}}}}}||},,|{{{{..,||,({{{{||}||{.(({......}))}}),||,,})}}}.,.||.}))}}...,,{|,..,)})}{(({{({,...})))))}(((((..(.((.(((((((((..........)))}}))))).)).)..)))))},))),.))))))))))))))).}))))............))))))))(((.(((((.((((((..(((.(((...........))).)).)..))).))).))))).))).....,,,,..{{{{|||,,,,|||}|||...{{{||,.,,,,,}}}}}...)))))..)))))))))).....((((......))))((((..{,..(((((((..(((((...{,{.(((((((((((.,............{((((.(((.(({...))).)))......))})).((.(((((.((((.,{,,..((..{,,.}|......((((.(((.,.(((.{{,.,,,))).))}}.))).)))}.,}}..}}.}}}}{((((((....))))))).)))).))))).)).,))))))))))).,,,.....|||.....}},(((((((....,(((..,......,.)))).))))))).})))).)))))))..}}..)))){((((.,......((((...((((.......((((((((((((((((((.,,.((((((((((((((.((..(((({(((((......)))))}........{{{((((....(((((({....))))}}))})}))))(((((....)))))....((((((((((...........)))))................)))))(((((((.,.........))))))).....)))).)).)))))...)))).)))))....)))))).......,.(((((......)))))....(((.(((((({....}.)))))).)))..(((((((......))))))){(((({....,|||}}}.....,,,...|,,}})}})),,..|{{{{{.............))))},...)))))))))))))))).))))..))))}.....)))))).}}...................................((((((,...,))))))((((..(((((((({(,((((,..,(((.........))))))).)))))),,,,,,...)))).)))))))))))))))))))))))))).||||{{|||||......(({{{{..,,..})}})))))))}..}},,..{(((((((.((({.{(((,.(((((.....((((.((..({,.....,),)).))))...)))))..,,))).(((.((({(((((......)))))...,(((((((......)))))))))))))){(((((.,,{{((,,,....(((((...(((..((((..........,......,,...((((.....))))..........,,.,,.|,,....,,..))))..)))))))).,}})))).))))))..})))))))))))........)))))))))))....,,,|||||,,,.....)))}),)))}}||...,,,,,.,..|{{{{.((,({{...,,{{{..((.((((((((,,((((((.......))))))((((((((((....))))))))))....,,,)),,.)))))))))),},}.......))).)}.,.))})},}||||......}})))}))))))))}}}},)}}}..((((((((((((..((({,(((((((...((((((,,(((((.(((.....))).))))))))))))......(((........))).,{{{.{,...|}.))){((((((.((((((((((((((((.........))))).))))))...))))).))))))}.....))).,))))))))..)))))))).))))........((((((..((((...))))..)))))).((((((((((....))),})))))).,((((.,.((((.......)))).,.))))}}}}}||...}}}}}.})))))|{,,....}}}}||,((((({...}))))),))))))))))).)))))..},,}},..,,.)))))))))))))}..}}}}(((((((((,.((((((((....)))))))).((((((.((((.{(,.....},}}.)))).))))))..,,,,{({..((((((((((,...,)))}))))))).})).,....{(((((((((....)))))))))}((........))|{{...((((...(((((((...(((.(((....((((((.((((.(((((......((((.((((.(((....))))))).))))..))))).)))).))))))))).)))...)))))))..)))).,)},.(((((.((.......)))))))((((((......)))))).,))))))))),......,,,||||,,..,,,.)))))))))))..))))))))).,.(((((((...,,,((((((.................)))))}..,,...)))))))(({(((,..,((((.{{{,||,,...)),)}).}}},....}))}))))))))).)))))))))))).)))))).)))))))....,,{({.((((((((.......)))))))).}}.((((..((.((((((..(((.((((...{((......)))....)))).)))....))))))))..)))),,|||||{({{{{{.{{||{|.{((((({{{(((((....))))}{(((.......))))...((((({...})))))((((((((.(.,.....,..).))))))))((((((.....))).))).............,}))))))}}....|||||||||,.})}}.}})))))))}..,,.|{{{{...(({{{..........,.,,,,,.(((((.(,....,}.)))))((((....))))...,|||,||.{{{.....,}}})},))}.....,,.,,.,,,|||}}...,.........})))),,,})))}..

Transcripts

ID Sequence Length GC content
GCAGCUGAGGACUUCCCCUCCGUGGUGACAGCCUCUGGGUCCUCGGUCG… 4575 nt 0.4046
Summary

This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain A subunit isoforms and is found in all tissues. Transcript variants derived from alternative polyadenylation exist. [provided by RefSeq, Jul 2008]

Forensic Context

A study in cynomolgus monkeys demonstrated that chronic cocaine exposure upregulated hippocampal expression of the ATP6V1A gene, which is involved in transport and neurotransmitter release, while methamphetamine and heroin exposure downregulated it compared to controls [Choi et al. DOI:10.30773/pi.2022.0004].