Basic Information

Symbol
RPL23
RNA class
mRNA
Alias
Ribosomal Protein L23 RpL17 UL14 L23 Large Ribosomal Subunit Protein UL14 60S Ribosomal Protein L17 60S Ribosomal Protein L23 Ribosomal Protein L17
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Postmortem interval inference

MANE select

Transcript ID
NM_000978.4
Sequence length
2706.0 nt
GC content
0.4368

Transcripts

ID Sequence Length GC content
CGGCGUUCAAGAUGUCGAAGCGAGGACGUGGUGGGUCCUCUGGUGCGAA… 2706 nt 0.4368
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L14P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL17 because the encoded protein shares amino acid identity with ribosomal protein L17 from Saccharomyces cerevisiae; however, its official symbol is RPL23. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Lucilia illustris identified the RPL23 as a constitutively expressed housekeeping gene used for qPCR normalization in experiments measuring differential gene expression for intrapuparial age estimation [Wang et al. DOI:10.1016/J.Forsciint.2018.02.025]. In Aldrichina grahami, the RPL23 was validated as one of the most stable reference genes at 22°C for qPCR normalization when analyzing the time-specific expression of target genes like Hsp23 and Hsp24, which are potential markers for estimating the minimum postmortem interval [Liu et al. DOI:10.1093/jme/tjaa144].