Basic Information

Symbol
RPL24
RNA class
mRNA
Alias
Ribosomal Protein L24 EL24 L24 Large Ribosomal Subunit Protein EL24 60S Ribosomal Protein L24 60S Ribosomal Protein L30 Epididymis Secretory Protein Li 310 Ribosomal Protein L30 HEL-S-310
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_000986.4
Sequence length
560.0 nt
GC content
0.4661

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-157.00 kcal/mol
Thermodynamic ensemble
Free energy: -170.00 kcal/mol
Frequency: 0.0000
Diversity: 153.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((((.((..........((.((((((((((((.....)).)))(((((...(.....((((((...........((((....)))).((((...))))......((.((((((((((((..(((((.......)))))..)))..))))))))).))...((((...))))..(((.....)))(((((((((.....................))))))))).(((....)))...........)))))))..)))))....((((....((((((((.....(((.....))).....))))))))....))))((((....))))........(((((..((((......(((...(((((((((.(((..((......(((..(((..((((((....))).)))....))))))......)).))).....)))))).))).)))......))))..)))))..........))))))).)))).)))))))))..((((...)))).((((.(((((((....))))))).)))).........
Thermodynamic Ensemble Prediction
......,(((((.((((((((,(({..,{{((.((({{{,||.||.{||{..{((({{((((({{{.((((((.,....,,,..((((....)))).((((...)))),{((((,,..,,,,}}}}}||{{(((({,....{(|...,)},.{{{{|..{((((({...,})))))..),)))},|...,,)))(((((((({{{......,...........,))))))))).{{{....}}}....}}...,.)))))).,{((((((..(((((....((((((((.....(((.....))).....))))))))....)))))..,...(((((((((.,...,.{{,...,,,..,.}))).)))))||||||..,..,{{.......||}.,}}.,)).......,}))))))..}}))|{{({{{..,|,,,,,.}...)))))),)).,}))))))))).)))))|,{,{(...{((((.((((((((,...})).)))....)))))))),))}|{{,.(((((({....})))))).})},.........

Transcripts

ID Sequence Length GC content
CUUUCUUUUCGCCAUCUUUUGUCUUUCCGUGGAGCUGUCGCCAUGAAGG… 560 nt 0.4661
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L24E family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as ribosomal protein L30 because the encoded protein shares amino acid identity with the L30 ribosomal proteins from S. cerevisiae; however, its official name is ribosomal protein L24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans analyzing blood samples from severely burned patients identified the RPL24 as a temporal expression profile gene exhibiting a significantly decreasing expression trend from 0 to 7 days after burn injury [Wu et al. DOI:10.1016/j.burns.2018.08.022]. This temporal pattern was validated in an independent dataset, where its aberrant expression in burn samples was consistent.