| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCUCUUACCGCCAUCUUGGCUCCUGUGGAGGCCUGCUGGGAACGGGA… | 1234 nt | 0.4368 | |
| CUUCUCUUACCGCCAUCUUGGCUCCUGUGGAGGUGAGUGAAGGGUCUGC… | 1312 nt | 0.4436 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L35AE family of ribosomal proteins. It is located in the cytoplasm. The rat protein has been shown to bind to both initiator and elongator tRNAs, and thus, it is located at the P site, or P and A sites, of the ribosome. Although this gene was originally mapped to chromosome 18, it has been established that it is located at 3q29-qter. Alternative splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Oct 2015]
A study in human postmortem brain tissue demonstrated that the RPL35A mRNA was hypomethylated in the nucleus accumbens of subjects with alcohol use disorder compared to matched controls, with a mean methylation level of 0.232 in cases versus 0.538 in controls [Liu et al. DOI:10.3390/genes13060958].