| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCCGGUCUUUCUGGUCUCGGCCGCAGAAGCGAGAUGACGAAGGGA… | 7573 nt | 0.4290 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L37E family of ribosomal proteins. It is located in the cytoplasm. The protein contains a C2C2-type zinc finger-like motif. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in humans using nanopore direct RNA sequencing of whole blood from pediatric sepsis patients identified the RPL37 as exhibiting significant differential transcript usage between bacterial and viral infections, with transcript ENST00000504562.1 showing increased usage in viral compared to bacterial infection [He et al. DOI:10.1186/s12879-025-11078-z]. An earlier microarray study in human blood leukocytes from monozygotic twins and unrelated individuals listed the RPL37 among the top 15 most highly expressed housekeeping genes with a low coefficient of variation, indicating low variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].