| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCUGGGCUCGGACCUAGGUCGCGGCGACAUGGCCAAACGUACCAAG… | 2992 nt | 0.4352 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L37AE family of ribosomal proteins. It is located in the cytoplasm. The protein contains a C4-type zinc finger-like domain. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in human backspatter samples from firearms demonstrated that the RPL37A was selected as a reference gene exhibiting minimal expression variance for normalizing mRNA expression data, confirming the compatibility of the "triple contrast" method with forensic RNA analysis from ballistic evidence [Grabmüller et al. DOI:10.1007/s12024-015-9695-3].