Basic Information

Symbol
RPL37A
RNA class
mRNA
Alias
Ribosomal Protein L37a L37A EL43 Large Ribosomal Subunit Protein EL43 60S Ribosomal Protein L37a
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000998.5
Sequence length
2992.0 nt
GC content
0.4352

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1092.00 kcal/mol
Thermodynamic ensemble
Free energy: -1145.96 kcal/mol
Frequency: 0.0000
Diversity: 595.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((.....(((..((((.((((..(.(((.........))).)...)))).))))...)))......(((((((......)))..))))))))))))..(((..((((((((((((.(((((((...((((((....((((((((((...(((.....)))....)))))).)))).((((((((((.........))))))))))....((((((((..((.((((..((......)).)))).)).)))))))).(((......)))...((((....)))).((((((...(((((((((((((((.(((........)))((((...((((((((.....))))))))....))))...........((((((.((((......((..((((....(.((((((((...)))))))))))))..))......)))).))))))..((((((...))))))))))))).((((((.((((((((((((....((((((((((((..(((..(((.............)))..)))..)))))))..).))))...))))).))))))))))))).(((..(((((.((((((((..((((.....)))))))))))).)))))..)))......(((((((((((...((((((((((((.(((((((((((..((......(((((((((.((((((((.((((.((((((((((.((((((..(((((.(((((((.(((((((((((((((((((((.(..((((((((((.(((((.((((((((((((..((.(((((((.(((((.......(((((((.((((.((((((.(((.(((((((.((((((((((((((((((.(((((((((((((((((.((((((((((.((((.((((((((((.((((...(((....)))...))))..)))))))))).)))).)))))))))).))))))))))))))))).)))))))))))))))))).))))))).)))....)))))).)))).))))))).......)))))))))))).))..)))))))))))).))))).))))))))))..).))))))))))))))))))))).))))))).)))))..)))))).)))))))))).)))).)))))))).)))))))))((((((((((((((((((....((((((.((((((((((((.((.............(((((.((((((((((((((((((((((......(((((((..((((....((((((.....((.....)).....))))))...))))..)))))))(((((((....((.......((((((......))))))......))..)))))))..(((........))).(((((((.((((...(.(((((((((((.((...........(((((((...(((.(((((.(((((((...((..............))...))).))))))))).))).))))))).........))))))))))))).)..))))....)))))))))))..))))))))))))))))))....)))))......(((((..(((((((.(((((((((((.....)))).)))))))....)))))))))))).(((((((....)))))))..((((((((.((((((((..((((((((((((((((((((.((.....(((...((((.(((.(((...........).)).)))))))..)))..)))))))...........((((((((.....))).)))))...(((((.....((((((((((..(.....)..)))))))))).....)))))(((((((((((....)))).))))))).....)))))))))..))))))...)))))))).))))))))((.((((((.(((((....((((((((((..((.(((((((((((((((((.......))))))))........(((((.((((((((.((((((((((((((((((((..((((((((((((((..(((((((((...)))))))))..(((((((........))))))).....((..(((..(((((((.(((((...))))).))))))).)))..)))))))))))))))...(((((.......))))).)..))))))..)))).))))).))))).)))))))))))))....))))...)))))((((......))))((((((....))))))....)).))))))).)))..)))))))))))..)))).))))))).)))).)...))))))))))))))))))))))))..))..))))))..))))))))...))))...)))))..))).)))))))).....(((.((((((((......(((....)))......)))))))).)))......((((((((...))))))))..(((....)))...........))))))))..))))))(((((............))))).)))))).(((((......))))).(((((((((....((.(((.(((.....((.((((((((.......)))))))).))..))).)))))..)))))))))...(((((..((((.((((((................(((((.......)))))((((((((.((((((((((((((..((((((((((((((........))).))).)))))))).........((((...))))..((((..........))))..........)))))))))))...((((.......))))....))))))))))))))))).))))..)))))...))))).)).))))).....)))))))..)))..(((((...)))))(((((((..((.((((((....))))))...)).))))))).............
Thermodynamic Ensemble Prediction
.,,{{{((({{{(((((..((((,{(((....{{|,,...,,.,))}.}...|}||,|}||.,,|},.....,|{{||||,....,))}..}))),}}}}},,.{(((,........,....,}|||||,,,,{{{{(({..,{{{|{{.{{,.||||||{({((((...{({{{{(((((((({.((((((((((((.(((..(((({{{{....((((((((..((.((((..((......)).)))).)).)))))))).(((......))).((((((((,.((((.((((((({(((.((((((((......))))),.{(((..((((...((((((((.....))))))))....))))..)))}.......|))))).}))))))).)))).,.)))))))).,{{{{...})))||{{{....)))}}))))..)))))))}})}|((((((...}}}}})}||||||,,,{{{{.((((((((((((....((((({((((({..{{{,,((,.......|,,,..}}},.}}),,))))))}..).))))...))))).)))))))}})))),||{..(((((.((((((((..((((,...,)))})))))))).))))}..,},......{((((((((((...((((((((({((.(((((((((((..((....,,(((((((((.((((((((.((((.((((((((((.((((((..(((((.(((((((.(((((((((((((((((((((.(..((((((((((.(((((.((((((((((((..((.(((((((.(((((..,....(((((((.((((.((((({.(((.(((((((.((((((((((((((((((.(((((((((((((((((.((((((((((.((((.((((((((((.((((...(((....))).,.))))..)))))))))).)))).)))))))))).))))))))))))))))).)))))))))))))))))).))))))).)))....}))))).)))).)))))))....,..)))))))))))).))..)))))))))))).))))).))))))))))..).))))))))))))))))))))).))))))).)))))..)))))).)))))))))).)))).)))))))).)))))))))||(((((((((((((((({,..,{((((.((((((((((((.((..{(({((((((,,((((.((((((((((((((((((((({.......((((((..((((....((((((.....((.....,,.....))))))...))))..)))))){(({....,}}},,,....||||{((({{{..{{(|,,,....}|},..,,,))))}}}||}..,,,.,,}.,{{{{||{.{{|{.,,{.(((((((((((.{(...........(((((((...,((.(((((.(((({{{...(({....,....,...}}...}}).))))))))).)}).))))))).........}}))))))))))).)..}|||,,..}})))))))))..))))))))))))))))))....))))}.,....(((({..(((((((.(((((((((((.....)))).)))))))....)))))))))))).{{(((((.,.,,}}}|||,.((((((((.((((((((..((((((((((((((((((((.{{.....(((...((((.(((.(((...........).)).)))))))..)))..}))))))},..,,,,...((((({{(.....))).)))))...(((((.....((((((((((.,{.....}..)))))))))).....)))))(((((((((((....)))).)))))))...,,}))))))))..))))))...)))))))).)))))))).((((((((.(((..,,...((((((((.,..(((((..((({{(((({((,...{{.||||||||,((({.,.,|}}}}|||||}}.}}.|.|||,|||....,{,,...,(((((((((((((..(((((((((...)))))))))..(((((((........}||||||.....(({{((,..{||||||.{,{{{,,|})))).,))))))}},}..}}))))))))))))),,,|,|||}}}}...,,,,)})}},.}}})}})))}},}))..)))))..}.))))))))...,,..))))).)))))),{{,,,...}}||{{{,{{,,,,))}}}},},,,|||||},,)}}}))))))).})))......)).))))))).)))).}...))))))))))))))))))))))},..))..))))))..)))))}}},,.))))...)))))..))).)))))))}.....(((.((((((((......(((....)))......)))))))).)))........,,,{,....}}}}||||{,((({.,,|}}....,||..|}}})})))}}..,,,||{((((....,.,.....}},.)})},)),.(((((......))))).(((((((((....((.(((.(((.....((.((((((((.......)))))))).))..))),))))}..)))))))))...((({{.,((((.{(((((,......,,,......(((((.......)))))((((((((.((((((((((((((.,((((((((((({{((,.....,))),))).))))))))........,((((..,||}}..{{{{.........,)))}.}}}}}....)))))))))))...{{{{,,.....)))),...)))))))))))}))))}.)))).,)))))))))}))))))))))))...}))))))}}}}))),.{((({...})))}.{{{{{{..{{.{{{{{{,,,.)))}))..,}),)))}}})}}}},}}......

Transcripts

ID Sequence Length GC content
CUUUCUGGGCUCGGACCUAGGUCGCGGCGACAUGGCCAAACGUACCAAG… 2992 nt 0.4352
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L37AE family of ribosomal proteins. It is located in the cytoplasm. The protein contains a C4-type zinc finger-like domain. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human backspatter samples from firearms demonstrated that the RPL37A was selected as a reference gene exhibiting minimal expression variance for normalizing mRNA expression data, confirming the compatibility of the "triple contrast" method with forensic RNA analysis from ballistic evidence [Grabmüller et al. DOI:10.1007/s12024-015-9695-3].